ID: 1062500633

View in Genome Browser
Species Human (GRCh38)
Location 9:136850539-136850561
Sequence GGCCCCAGGATCCACCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062500629_1062500633 -7 Left 1062500629 9:136850523-136850545 CCCTCTGGGCGCCTCAGGCCCCA 0: 1
1: 0
2: 5
3: 18
4: 259
Right 1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1062500626_1062500633 4 Left 1062500626 9:136850512-136850534 CCCACGTGCGTCCCTCTGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1062500622_1062500633 20 Left 1062500622 9:136850496-136850518 CCACCAGCAGATGAGACCCACGT 0: 1
1: 0
2: 2
3: 6
4: 93
Right 1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1062500630_1062500633 -8 Left 1062500630 9:136850524-136850546 CCTCTGGGCGCCTCAGGCCCCAG 0: 1
1: 0
2: 3
3: 41
4: 367
Right 1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1062500627_1062500633 3 Left 1062500627 9:136850513-136850535 CCACGTGCGTCCCTCTGGGCGCC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1062500623_1062500633 17 Left 1062500623 9:136850499-136850521 CCAGCAGATGAGACCCACGTGCG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG 0: 1
1: 0
2: 0
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062500633 Original CRISPR GGCCCCAGGATCCACCATCA AGG Intronic
900647515 1:3715612-3715634 GGCACCTGGGTCCACCCTCATGG - Intronic
901387608 1:8921404-8921426 GGCGACTGCATCCACCATCAGGG + Intergenic
901665235 1:10822533-10822555 GGCCCTTGGAGCCACCATCAGGG + Intergenic
902324972 1:15693932-15693954 GGCATCAGGATTCACCACCACGG + Intronic
902404936 1:16177442-16177464 GGCCCCAGATGCCACCACCAAGG + Intergenic
904286246 1:29454829-29454851 AGCCCCAGGGTCCACCATCTGGG + Intergenic
904417994 1:30374551-30374573 AGCCCCAGGCTCCACCATCTGGG - Intergenic
905276983 1:36824747-36824769 GGCCCCAGCAGCCACCAACCCGG + Intronic
906142674 1:43543106-43543128 GGCTCCAGGATGGTCCATCAGGG + Intronic
906187930 1:43875685-43875707 GGCCTCAGGAAACACAATCATGG - Intronic
906809327 1:48810163-48810185 GTCCCCAGGAGCCAGCCTCAAGG - Intronic
907653386 1:56318183-56318205 GGCCCAAATATGCACCATCATGG + Intergenic
908754956 1:67461149-67461171 GGCCCCAGGGTCCAGCCCCAAGG + Intergenic
910232585 1:85001454-85001476 GGCCACAGAATCCAAGATCAAGG - Intronic
913300620 1:117366433-117366455 GGCCCGAGGATTCAGCAACAGGG - Intergenic
915031205 1:152881786-152881808 GGCCTCAGGAAACACAATCATGG + Intronic
915886516 1:159728182-159728204 GGCCTCAGGAAACACAATCAAGG + Intergenic
920114425 1:203609942-203609964 GGCCCCAGCATCCAGCCTCAGGG + Intergenic
923410002 1:233698712-233698734 GGCCTCAGGAAACACAATCATGG + Intergenic
924580317 1:245317725-245317747 GGCCCCTTGGTCCAGCATCAGGG - Intronic
1064627953 10:17280877-17280899 GGCCTCAGGAAACACAATCATGG + Intergenic
1070225858 10:74504843-74504865 GGCCTCAGGAAACACAATCATGG - Intronic
1071197490 10:83178022-83178044 GGCCTCAGGAAACACAATCATGG + Intergenic
1074158695 10:110819696-110819718 GACCCCAGGGTTAACCATCACGG - Intronic
1075553551 10:123412204-123412226 GGCCTCAGGAAACACAATCATGG - Intergenic
1076180453 10:128403023-128403045 GGCCCCGTGACCCTCCATCATGG - Intergenic
1076539379 10:131204533-131204555 GAAGCCAGGACCCACCATCACGG - Intronic
1077046788 11:550251-550273 GGCCCCTGGCCCCACCAACAAGG + Exonic
1077385320 11:2266948-2266970 GGACCCAGGCTCCACGAGCACGG + Intergenic
1083694947 11:64436549-64436571 GGCCCCAGGAACCCCCTCCAGGG - Intergenic
1085053379 11:73390963-73390985 GGCCCCAGGATCCAGAGTCCTGG - Intronic
1085391258 11:76183500-76183522 GGCCCCAGCATCCACCTCCCCGG + Intergenic
1085458737 11:76680541-76680563 GGCCACAGGAGCCAGCATCCAGG + Intergenic
1089169395 11:116501517-116501539 AACCCCAGCTTCCACCATCAGGG + Intergenic
1089356627 11:117858155-117858177 GGCACCAGGATGCTCCAGCATGG - Intronic
1090434843 11:126677967-126677989 GTCCCCAGGCTCCAGCTTCATGG + Intronic
1091601909 12:1922894-1922916 GGCTACAAGATCCACCATCTTGG + Intergenic
1096184933 12:49572685-49572707 GGCCCCAGGCTCCATCTTCTGGG + Intronic
1099558832 12:84147706-84147728 GGCCTCAGGAAACACAATCATGG - Intergenic
1100810141 12:98329764-98329786 GGCCTCAGGAAACACAATCACGG + Intergenic
1103269137 12:119657634-119657656 AGCCCCAGGAAACACAATCATGG + Intergenic
1105812974 13:24010794-24010816 GGCCCTCAGATCCACCAACAAGG - Intronic
1109804837 13:67425641-67425663 GGCCTCAGGAAACACAATCATGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114780574 14:25534005-25534027 GGCCTCAGGAAACACAATCATGG + Intergenic
1115505138 14:34086613-34086635 GGCCTCAGGAAACACAATCATGG + Intronic
1119445767 14:74662109-74662131 GGGTCCGGGATCCAGCATCAGGG - Exonic
1120152280 14:81049893-81049915 GGCCTCAGGAAACACAATCATGG - Intronic
1120771262 14:88382970-88382992 GGCCTCAGGAAACACTATCATGG - Intergenic
1120976896 14:90256796-90256818 GGCCCCAGGATCCCCGGGCAAGG - Intronic
1121738972 14:96238199-96238221 GGCCAGAGGATCCACTTTCAAGG + Intronic
1121856732 14:97277095-97277117 GGCCCCTTGATCCATTATCATGG + Intergenic
1122008621 14:98727241-98727263 GGCCCCAGGATGCGCCAACGTGG - Intergenic
1124640281 15:31392514-31392536 GGACCCAGGATGCGCCGTCAGGG - Intronic
1127144511 15:56010734-56010756 GGCCTCAGGAAACACAATCATGG - Intergenic
1128457874 15:67843040-67843062 GGCCCCAGGATCAGCCCCCAGGG + Intergenic
1128807313 15:70540470-70540492 GGCCCCAGGATCCCACAGCAGGG - Intergenic
1128983149 15:72200698-72200720 GGCCCCAGGAAGTACCCTCAGGG + Intronic
1130858628 15:87865386-87865408 GGCCTCAGGATTCATTATCAAGG + Intronic
1130865655 15:87931204-87931226 AGCCCCAAGAGCCACCAGCAGGG - Intronic
1131105251 15:89729478-89729500 GGCCCCAGGAACAGCCCTCATGG + Intronic
1132219110 15:100091891-100091913 AGACCCAGGAACCACCATTAGGG - Intronic
1132659562 16:1055316-1055338 AGCCCCAGGACCCCGCATCAGGG - Intergenic
1132749969 16:1452970-1452992 GGGCCCAGTGTCCTCCATCAGGG - Intronic
1133217894 16:4304500-4304522 CGCCCCAGGATGGACCAGCAGGG - Intergenic
1136380927 16:29895258-29895280 GGCTTCAGGATCCACTATCAGGG - Exonic
1136416088 16:30104708-30104730 GGCCCCAGGCTCCAGCCTCAGGG + Intergenic
1138023277 16:53503301-53503323 GGCCCCAGGATCGTGCAGCAGGG - Intronic
1139094117 16:63684262-63684284 ACCCCCAGGGTTCACCATCATGG + Intergenic
1139333296 16:66210955-66210977 GGGCCCAGGACCCATCCTCAAGG - Intergenic
1140863576 16:79040410-79040432 GACCACAGGATGCACCACCATGG + Intronic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143972128 17:10803477-10803499 GGCCACAGGATCCCCAGTCAGGG + Intergenic
1146627513 17:34445560-34445582 TGGCCCAGGACACACCATCAGGG + Intergenic
1148201534 17:45753091-45753113 GGCCCCAGACTCCTCCACCATGG + Intergenic
1149507936 17:57211397-57211419 GGTCCCAGGAGGCACCCTCAAGG + Intergenic
1149658056 17:58320491-58320513 GGCCCCCAGTTCCACCATCTTGG - Intronic
1151433396 17:74079966-74079988 GGCCCCTGGATCCTACACCAGGG + Intergenic
1156455174 18:37289149-37289171 CACCCCACGATCCCCCATCATGG - Intronic
1157212155 18:45752830-45752852 GGCCCTGGGCACCACCATCAGGG + Intergenic
1159212818 18:65349048-65349070 GGCCTCAGGAAACACAATCACGG - Intergenic
1160346701 18:78138083-78138105 GGGCCCTGGACACACCATCATGG - Intergenic
1161065068 19:2233451-2233473 GGCCCCAGGATCCACCTAACTGG - Exonic
1161579955 19:5075266-5075288 GGCCCCCGGAACCAACACCAGGG - Intronic
1163120060 19:15212082-15212104 GGTCCCAGCATCCCCCAGCATGG + Intergenic
1164593269 19:29517743-29517765 GGCCCCAGGACCCATTCTCAGGG + Intergenic
1167668056 19:50834106-50834128 TGCCCCGGGATCCAGAATCAAGG - Intronic
1167700743 19:51043707-51043729 GGCCACAGCATCAACCTTCAAGG + Intergenic
925929947 2:8698879-8698901 GGCCACAGGGTCCTGCATCAGGG + Intergenic
925969766 2:9098241-9098263 GCCTCCTGGACCCACCATCAGGG - Intergenic
927098775 2:19770635-19770657 GGCCTCAGGAAACACAATCATGG + Intergenic
927462055 2:23307729-23307751 GGCCTCAGGAAACACAATCATGG + Intergenic
927845651 2:26471036-26471058 GGCCAAAGGGTCCAGCATCAGGG - Intronic
928899388 2:36301177-36301199 GGCCTCAGGAAACACAATCATGG + Intergenic
932701852 2:73997571-73997593 GGACCCAGGATACACCAGGAAGG - Intronic
932777195 2:74535482-74535504 AGGCCCAGGATCCAGCATCTTGG + Intronic
934653322 2:96104438-96104460 GGCCCCAGGCTGCCCCCTCAGGG - Intergenic
937869477 2:126777103-126777125 GGCCCCAGGGTCCACATTCCTGG - Intergenic
937937211 2:127255907-127255929 AGCCCCAGGAACCAGCAACAGGG - Intergenic
939210684 2:139171533-139171555 GGCCCAAGTAACCTCCATCATGG + Intergenic
942726986 2:179020533-179020555 AGCCACAGGATCCAACATCATGG + Intronic
945411553 2:209515432-209515454 GGCCCCAGGAAACACAATCATGG + Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
948029933 2:234809275-234809297 GGCCCCAGGCTCACCCATAATGG + Intergenic
1168914035 20:1471915-1471937 GCCCCAAGGAACCCCCATCAAGG - Intronic
1171096514 20:22337225-22337247 AGCAACAGGATCCACCATGAGGG + Intergenic
1171969083 20:31552142-31552164 ACCCCCAGGCTCAACCATCAAGG - Intronic
1172945360 20:38683510-38683532 GGCCCCAAAATCCAACTTCAGGG + Intergenic
1173248437 20:41351966-41351988 GGGCCAAGGGTCCACTATCAAGG + Intronic
1173917832 20:46722580-46722602 GGCCCAAATATCCATCATCATGG + Intronic
1174390047 20:50213515-50213537 GGCCCCAAGCCCCACCTTCATGG + Intergenic
1174541459 20:51292984-51293006 GGCCTCAGGAAACACAATCATGG + Intergenic
1179642856 21:42758735-42758757 CGCCCCAGGATCCACCTGCCAGG + Intronic
1179793976 21:43771704-43771726 GGCCTCAGGAAACACAATCATGG + Intergenic
1180942498 22:19668487-19668509 GGCCCCACGATCCTGCCTCATGG - Intergenic
1181395522 22:22618538-22618560 GGCCACAGGAAGCAGCATCAGGG + Intergenic
1181480931 22:23198641-23198663 TGCCCCAGGCACCACCAGCATGG - Intronic
1181737296 22:24892091-24892113 GGCCCCAGCAGCCTCCATCCAGG - Intronic
1181881230 22:25981984-25982006 GGCCTCAGGAAGCACAATCATGG + Intronic
1183685637 22:39359918-39359940 GGCCCAAGGATCTAGGATCAGGG - Intronic
1184074869 22:42169814-42169836 GGCCCCAAGAGCTACCAGCAGGG - Intronic
951034851 3:17921635-17921657 GGCCTCAGGAAACACAATCATGG - Intronic
952120139 3:30232459-30232481 GGCCTCAGGAAACACAATCAAGG + Intergenic
954472034 3:50706123-50706145 GGCCTCAGGAAACACAATCATGG - Intronic
954638543 3:52084760-52084782 GGCCCCAGGTACCACCACCCAGG - Intronic
955541771 3:59984277-59984299 GGGCCCAGGAAGCACCATTAGGG + Intronic
956825360 3:72993018-72993040 GGCTGGAGGATCCACCTTCAAGG + Intronic
957784638 3:84866338-84866360 GGCCTCAGGAAACACAATCATGG - Intergenic
958638608 3:96777138-96777160 GGGCCCAGGGGCCACCACCAAGG + Intergenic
961103812 3:124223919-124223941 CTCCCCAGGATCCTCCAGCATGG - Intronic
961380994 3:126496453-126496475 AGCCCCCGCATCCACCATCCTGG - Intronic
969103498 4:4787694-4787716 GGCCTCAGGAAACACAATCATGG - Intergenic
969343286 4:6555869-6555891 GGTCCCAGTCTCCAACATCAGGG - Intronic
969700420 4:8764776-8764798 CGCCCCAGGATCCACTCTCTTGG + Intergenic
973040667 4:45466256-45466278 GGCCTCAGGAAACACAATCATGG + Intergenic
977138724 4:93339786-93339808 GGCCTCAGGAAACACAATCATGG + Intronic
978529281 4:109698016-109698038 GCCCCCAGGATCCAGCAACCAGG + Intronic
978917596 4:114145836-114145858 GTCCCCAAGATCCTTCATCAAGG - Intergenic
981206763 4:142050806-142050828 GGCTCCAGGATGGACCACCATGG + Intronic
985534752 5:457727-457749 GGACCCAGGAGCCACCCCCATGG - Intronic
986567109 5:9126184-9126206 GGCCCCAGCAGACACCACCATGG + Intronic
988119453 5:26942111-26942133 GGCCTCAGGAAACACAATCATGG + Intronic
989149590 5:38285708-38285730 GGCCTCAGGAAACACAATCATGG + Intronic
991288714 5:65009932-65009954 GGCCTGAGGATCAAACATCATGG - Intronic
991663134 5:68970296-68970318 GGCCTGAGGATGCACCATCAGGG - Intergenic
994545054 5:101155724-101155746 GGCCCCAGGAAACACAATCATGG + Intergenic
996026863 5:118656628-118656650 GGCCTCAGGAAACACAATCATGG + Intergenic
996406119 5:123105945-123105967 GGCCCCAGGCTCCAGCCTAATGG + Intronic
997732649 5:136192443-136192465 GGCCCCAGGAGCCACGGTCAAGG - Intergenic
1000350535 5:160349308-160349330 GGCCTCAGGCTCCACCATCCTGG - Exonic
1005430686 6:25753693-25753715 TGGCCCAGGATCCCCCATCTTGG - Intergenic
1007262804 6:40575509-40575531 GGCCCCAATATCCACCATTTTGG - Intronic
1010731463 6:79395874-79395896 GCCCCCGTGATCCACCATAAGGG + Intergenic
1014282613 6:119458436-119458458 GGCCTCAGGAAACACAATCATGG - Intergenic
1014403035 6:121014825-121014847 GGCCTCAGGAAACACAATCATGG + Intergenic
1014951359 6:127559234-127559256 GGCCTCAGGAAACACAATCATGG - Intronic
1017382576 6:153847526-153847548 TGCCCCTTGATCCAACATCACGG + Intergenic
1017823428 6:158064780-158064802 GGCCCCAGGGACCCCCCTCACGG + Intronic
1019128086 6:169854508-169854530 GGCCCCACTCTCCACCCTCAGGG - Intergenic
1020880478 7:13755923-13755945 AGCACCAGGCTCCACTATCAAGG + Intergenic
1022268664 7:28784577-28784599 GGCTTAAGGATCCATCATCAGGG - Intronic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1026212050 7:68314395-68314417 GTCCCCAGGCTCTACCCTCAGGG - Intergenic
1027815246 7:82959958-82959980 GGCCTCAAGATACACCACCATGG - Intronic
1033730668 7:144175815-144175837 GGCCTCAGGAAACACAATCATGG - Intergenic
1033843324 7:145401999-145402021 GGCCACAGGAAACACAATCATGG - Intergenic
1034229599 7:149511387-149511409 GGCCTCAGGAAACACAATCATGG - Intergenic
1034477638 7:151296018-151296040 GGCCTCAGGAAACACAATCATGG + Intergenic
1034926703 7:155128509-155128531 GGCCTCAGGAAACACAATCATGG - Intergenic
1034937495 7:155209493-155209515 GACCCCAGGACCCCCCATCCTGG + Intergenic
1035109720 7:156470985-156471007 GGCCTCAGGAAACATCATCATGG - Intergenic
1035285731 7:157805793-157805815 GGCCCCAGGAGCCCCCACCTTGG + Intronic
1035397996 7:158547637-158547659 GGCTCCAGTCTCCACCAGCAGGG - Intronic
1035492616 7:159293563-159293585 ATCCACAGCATCCACCATCAGGG + Intergenic
1036709519 8:11069146-11069168 GGCCCTAGGATCCTCCTTAATGG + Intronic
1036783938 8:11672960-11672982 GGCCCCATTCTCCACCATCCCGG + Intergenic
1037294450 8:17385785-17385807 GGCCACAGGAAACACAATCATGG - Intronic
1037504241 8:19514945-19514967 GGCTCCAGGATGGTCCATCAGGG - Intronic
1038188211 8:25294791-25294813 GGCCTCAGGAAACACAATCATGG + Intronic
1038898763 8:31818431-31818453 GGCACCAGGAACCAGTATCATGG + Intronic
1039581012 8:38666886-38666908 AGCCCCAGGCTCCAGCAGCAGGG - Intergenic
1040481393 8:47831182-47831204 GGCCTCAGGCTCCACAAGCATGG + Intronic
1043116065 8:76255235-76255257 AGCACCTGTATCCACCATCAGGG + Intergenic
1044834842 8:96285971-96285993 GGCCCTAGGATGCACAATTATGG + Intronic
1047830016 8:128618833-128618855 GGCCCCTGGCTCCAACACCAAGG - Intergenic
1053138104 9:35664455-35664477 GGCCCCAGCATCCTCCTTCCAGG + Exonic
1057199696 9:93133618-93133640 GGCCCCAAGTTCCCCCATCAAGG + Intronic
1058066044 9:100549184-100549206 GGCCTCAGGAAACACAATCATGG + Intronic
1058350001 9:104010098-104010120 GGCCTCAGGAACCACAATTATGG - Intergenic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1060151127 9:121289087-121289109 GGCCCCAGGCACCAACATAATGG - Intronic
1060732976 9:126049704-126049726 GGTCCCAGGATCCCCCAGCGAGG + Intergenic
1062148995 9:135007800-135007822 AGCCCCAGGCCTCACCATCAGGG + Intergenic
1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG + Intronic
1062618844 9:137410632-137410654 GGCCCCACGATCCACACCCAGGG + Intronic
1186042148 X:5492401-5492423 GGCCTCAGGAAACACAATCATGG - Intergenic
1191876859 X:65806645-65806667 GGCCCCAGGATCCCTGGTCAGGG + Intergenic
1193850628 X:86532560-86532582 GGCCTCAGGAAACACAATCATGG - Intronic
1194916888 X:99718108-99718130 GGCTCCAGGATCACCCACCATGG + Intergenic
1195707466 X:107748425-107748447 AGCCCCAGAAGTCACCATCATGG + Intronic
1200266642 X:154649677-154649699 GGCCCCTGCAGCCAACATCACGG - Intergenic
1202386549 Y:24332090-24332112 GGCCTCAGGAAACACAATCATGG + Intergenic
1202484236 Y:25338038-25338060 GGCCTCAGGAAACACAATCATGG - Intergenic