ID: 1062504240

View in Genome Browser
Species Human (GRCh38)
Location 9:136865330-136865352
Sequence CTCATGGGGTCCCCTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062504233_1062504240 2 Left 1062504233 9:136865305-136865327 CCACCTGTGCAACAGGGTCCACC 0: 1
1: 0
2: 1
3: 21
4: 186
Right 1062504240 9:136865330-136865352 CTCATGGGGTCCCCTGAAGCAGG No data
1062504229_1062504240 10 Left 1062504229 9:136865297-136865319 CCCATCTTCCACCTGTGCAACAG 0: 1
1: 0
2: 1
3: 11
4: 204
Right 1062504240 9:136865330-136865352 CTCATGGGGTCCCCTGAAGCAGG No data
1062504230_1062504240 9 Left 1062504230 9:136865298-136865320 CCATCTTCCACCTGTGCAACAGG 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1062504240 9:136865330-136865352 CTCATGGGGTCCCCTGAAGCAGG No data
1062504234_1062504240 -1 Left 1062504234 9:136865308-136865330 CCTGTGCAACAGGGTCCACCTGC 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1062504240 9:136865330-136865352 CTCATGGGGTCCCCTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062504240 Original CRISPR CTCATGGGGTCCCCTGAAGC AGG Intronic
No off target data available for this crispr