ID: 1062516461

View in Genome Browser
Species Human (GRCh38)
Location 9:136939434-136939456
Sequence CCAACTCCTGGTCTCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062516461_1062516470 6 Left 1062516461 9:136939434-136939456 CCCAGCTGGAGACCAGGAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 336
Right 1062516470 9:136939463-136939485 AGAGGCTCCGTCCCTCTGGGTGG No data
1062516461_1062516469 3 Left 1062516461 9:136939434-136939456 CCCAGCTGGAGACCAGGAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 336
Right 1062516469 9:136939460-136939482 GGCAGAGGCTCCGTCCCTCTGGG No data
1062516461_1062516468 2 Left 1062516461 9:136939434-136939456 CCCAGCTGGAGACCAGGAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 336
Right 1062516468 9:136939459-136939481 GGGCAGAGGCTCCGTCCCTCTGG No data
1062516461_1062516474 21 Left 1062516461 9:136939434-136939456 CCCAGCTGGAGACCAGGAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 336
Right 1062516474 9:136939478-136939500 CTGGGTGGCGCAGCCTCTCTCGG No data
1062516461_1062516475 24 Left 1062516461 9:136939434-136939456 CCCAGCTGGAGACCAGGAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 336
Right 1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062516461 Original CRISPR CCAACTCCTGGTCTCCAGCT GGG (reversed) Intronic
900525636 1:3127043-3127065 CCCACTGCAGGCCTCCAGCTCGG - Intronic
901303851 1:8218238-8218260 TCAACTCCTGTGCTCCAGCCTGG - Intergenic
901695008 1:11001008-11001030 CAAACTCCTGGGCTCAACCTTGG - Intergenic
902394221 1:16123862-16123884 CCAGTTGCTGGGCTCCAGCTTGG + Intergenic
902434794 1:16391559-16391581 CCACGTCCTGGTCTCCAATTTGG - Intronic
902546495 1:17193741-17193763 CCACCCCCTGCTCTCCAGCCTGG - Intergenic
903580243 1:24365326-24365348 CCAACTCATGCTCCCCAGCAAGG - Intronic
903879610 1:26500215-26500237 CCCACTCCTGGACCCTAGCTCGG + Intergenic
904587161 1:31586846-31586868 CCAACTCCTGGGGCCCAGCCTGG + Exonic
905652496 1:39665859-39665881 CCCACGCCTGGTAACCAGCTTGG - Intronic
906834307 1:49066574-49066596 CCAACTCAAGGCCTCCAACTTGG + Intronic
907050109 1:51324563-51324585 CGCACTACTGGTCTCCAGCCCGG - Intronic
907520748 1:55021919-55021941 CCATCTCAGTGTCTCCAGCTGGG + Intergenic
907981479 1:59486178-59486200 CCAACGCATGGTCTCCCTCTGGG - Intronic
908223405 1:62032114-62032136 CCAACGCCTTGACTTCAGCTTGG - Intronic
908347203 1:63246188-63246210 AGAACTCCTGGCCTCCACCTTGG + Intergenic
908713885 1:67049248-67049270 CCCACTACTGGACTCCAGCCTGG + Intronic
909024733 1:70468707-70468729 CCAACTCCTGTTCTACCTCTGGG - Intergenic
910919861 1:92332706-92332728 CCAAGTCCTGGTCTCATACTTGG + Intronic
911366609 1:96946488-96946510 GCAATTCCTGGTCTCCTACTTGG + Intergenic
912903798 1:113681816-113681838 CCAACTCCCTGTCTCCAGGTAGG - Intronic
913281793 1:117191918-117191940 TGAACTCCTGTTCTCCAGCTTGG + Intronic
913434286 1:118831055-118831077 CCAAATCCTGTTCTACTGCTGGG + Intergenic
914686257 1:149982501-149982523 CAAACTCCTGCACTCCAGCCTGG - Intronic
915591567 1:156873986-156874008 CCCACTCCTGGGCTCCTCCTGGG + Intronic
916120286 1:161523475-161523497 CTGAGTCCTGGTCTCCAGCTGGG + Intronic
916130050 1:161605128-161605150 CTGAGTCCTGGTCTCCGGCTGGG + Intronic
916747810 1:167697787-167697809 CTCACTGCTGGTCTCCAGCTGGG - Exonic
916906692 1:169293254-169293276 CCAACCACTGAACTCCAGCTTGG + Intronic
917929136 1:179811947-179811969 CCAAGTCCAGGTCTCCAGCTGGG - Intronic
917931990 1:179828937-179828959 CCACTTCCAGGTTTCCAGCTGGG - Intergenic
918265208 1:182836082-182836104 CCAACTCCTGGGCTGCAGACCGG - Intergenic
919159374 1:193808283-193808305 CCAACCTCTTGTCTCCACCTTGG - Intergenic
919808737 1:201396234-201396256 CCACCTCCTGGCCTTCATCTGGG + Intronic
920766109 1:208835363-208835385 CCAACTATTGCTCTGCAGCTTGG + Intergenic
922031174 1:221800996-221801018 TCACCTCCTGGTGTGCAGCTGGG - Intergenic
922743886 1:228032198-228032220 CTTCCTCCTGGCCTCCAGCTGGG - Intronic
922846543 1:228689551-228689573 CCAACTCCTGGGCTGCAGACAGG + Intergenic
922900325 1:229131479-229131501 GCACCTGCTGGTTTCCAGCTTGG - Intergenic
923556736 1:235006977-235006999 CCAACTCCTGGCACCCAGCATGG + Intergenic
924323151 1:242869576-242869598 ACAACTCCTGGCCTGCTGCTGGG - Intergenic
924450933 1:244178432-244178454 CCCACCCCTGCACTCCAGCTTGG + Intergenic
924907546 1:248472636-248472658 CCTACTGCTGCTCTCCTGCTCGG + Intergenic
924916562 1:248575452-248575474 CCTACTGCTGCTCTCCTGCTCGG - Intergenic
1063088690 10:2842229-2842251 CCTACACCTGGTGTCCAGCCTGG + Intergenic
1063701339 10:8388008-8388030 CCAACTCCTGAGCTCAAGCAAGG + Intergenic
1064665538 10:17647123-17647145 CCAAAAACTGGTCTACAGCTAGG - Intronic
1066393148 10:34995007-34995029 CCAAGTCCTGAGCTCCAGTTGGG - Intergenic
1066434050 10:35380353-35380375 CCCACTCCTGATTTCCACCTGGG + Intronic
1067053644 10:43039136-43039158 CCAGCTGCTGGACACCAGCTTGG - Intergenic
1068489516 10:57705596-57705618 CAAACTCCTGGCCTCAGGCTCGG - Intergenic
1068559182 10:58494106-58494128 CCAACTTCTCTTCTCTAGCTAGG - Intergenic
1069034998 10:63637259-63637281 CCAACTCCTAGTTTCTAACTTGG - Intergenic
1070393690 10:75993124-75993146 CAAACTACTGGTCTCCTCCTGGG + Intronic
1072152045 10:92691174-92691196 GCAGCTCCTGGTCGCCAGTTAGG + Intronic
1072506848 10:96076359-96076381 CAAACTCCTGGGCTCAAGCAGGG - Intergenic
1073007071 10:100332718-100332740 TGAACTCCTAGTCTCAAGCTCGG - Intergenic
1073561255 10:104498811-104498833 CCAACTACTGGCCTTTAGCTGGG - Intergenic
1075072026 10:119326044-119326066 CCAACATCTAGCCTCCAGCTGGG + Intronic
1075623607 10:123946238-123946260 CCTCCTCCTGGTCTCCATCATGG - Intergenic
1075710033 10:124525947-124525969 CCACCTCCCGGCCTCCACCTGGG - Intronic
1076154709 10:128194769-128194791 CCAATTCCTGCTCTCCAGAGGGG - Intergenic
1076769750 10:132656524-132656546 CTGACTCCTTGACTCCAGCTGGG - Intronic
1076873159 10:133203314-133203336 CAAACTCATGGTGTCCAGCAGGG + Intronic
1076905523 10:133358828-133358850 CCCACAGCTGGTGTCCAGCTGGG - Intergenic
1077110741 11:860946-860968 CCAGCTCCCGGTCTGCAGCGTGG - Intronic
1077318119 11:1928272-1928294 CCCCCTCCTGGGCCCCAGCTGGG + Intronic
1077325230 11:1960882-1960904 CCATCTTCTGGCCTCCAGCAGGG + Intronic
1077334232 11:1996405-1996427 CCACAGCCAGGTCTCCAGCTGGG - Intergenic
1077622226 11:3736539-3736561 CCACTTCCTGGGTTCCAGCTGGG - Intronic
1077961963 11:7084956-7084978 CCAGCTCCTGGACACCAACTGGG - Intergenic
1079443160 11:20535275-20535297 TCAGCTCTTGGTCCCCAGCTTGG - Intergenic
1081152110 11:39645667-39645689 ACAGCTCCTACTCTCCAGCTCGG + Intergenic
1081152671 11:39651880-39651902 CCCAGTCCTGGACTCCAGCGTGG + Intergenic
1081502904 11:43684096-43684118 CCATCTCCTGGTCAAGAGCTGGG + Intronic
1081633215 11:44703192-44703214 CCAACTCCTAGCCTCTGGCTGGG + Intergenic
1083784475 11:64935878-64935900 CCTCCTGCTGGTCTCCAGCTTGG + Exonic
1084764783 11:71301293-71301315 TCAACTTCTGGCCTCCAGCCGGG - Intergenic
1087374687 11:97326384-97326406 CCAACTGCTGGTCACCAGACAGG - Intergenic
1088200103 11:107322863-107322885 CCCAATCCTGGACTACAGCTTGG + Intergenic
1088939245 11:114436927-114436949 CCAACTCCTTGGCTGCAGATCGG - Intronic
1090491693 11:127168772-127168794 CCCACCCCTGCACTCCAGCTGGG + Intergenic
1091236962 11:134028637-134028659 CTGACTCCTGCTCTCCTGCTTGG - Intergenic
1202808211 11_KI270721v1_random:16061-16083 CCATCTTCTGGCCTCCAGCAGGG + Intergenic
1202817215 11_KI270721v1_random:51587-51609 CCACAGCCAGGTCTCCAGCTGGG - Intergenic
1091818350 12:3456107-3456129 CCAACTCCTGGCCATGAGCTAGG + Intronic
1091928986 12:4379474-4379496 CCCACTGCTCGGCTCCAGCTGGG - Exonic
1092197156 12:6556254-6556276 CCACCGCCTGGACTCCAGCCGGG + Intergenic
1092485310 12:8897829-8897851 CCACCGCCTGGTCTCCATCTTGG - Intergenic
1093410455 12:18858967-18858989 CCTACTTACGGTCTCCAGCTGGG - Intergenic
1095053137 12:37571892-37571914 CAAACTCCTGGCCTCAAGCAAGG - Intergenic
1096287932 12:50316355-50316377 CCAACTCCTGGCCTCAAGTGAGG - Intergenic
1101635499 12:106537350-106537372 CCAACTCCTGGTCTGCAGACCGG + Intronic
1101921598 12:108937570-108937592 CCAAGTCCAGGTTTCCAGGTTGG - Intronic
1102225543 12:111225677-111225699 CCACCTGCAGATCTCCAGCTGGG - Intronic
1102299085 12:111758176-111758198 CCAAGGCCTGGACTCCTGCTGGG - Intronic
1102359775 12:112274943-112274965 CAAAGTCCTAGCCTCCAGCTTGG - Exonic
1104269808 12:127273014-127273036 ACAAATCCTGGACTTCAGCTTGG - Intergenic
1104473116 12:129046907-129046929 TCAACTCTTCGTCTTCAGCTGGG + Intergenic
1104616523 12:130274738-130274760 CCCACTCCTGCCCTCCAGCCTGG - Intergenic
1105708140 13:22981555-22981577 CCACCCCCTAGTCTGCAGCTGGG + Intergenic
1106109455 13:26763511-26763533 CCAACTCCAGGTCTGGAGGTCGG + Intergenic
1107014225 13:35695737-35695759 TCATCTCCGGCTCTCCAGCTTGG - Intergenic
1107291963 13:38864685-38864707 CCAACTCCAGTTTTCCATCTTGG + Intronic
1108399108 13:50021332-50021354 CCAACTCCTGCACTCCAGCCTGG - Intergenic
1108744820 13:53382080-53382102 ACATCTCCTGGTTTCCAGCTAGG - Intergenic
1108757127 13:53517108-53517130 CCAGCTTCTGCTCTCCAGCTTGG + Intergenic
1110403918 13:75127336-75127358 CCCACTACTGGCCTCCAGCCTGG - Intergenic
1110756690 13:79183334-79183356 CCAACTCCTGAGCTCCTGGTGGG - Intergenic
1111668993 13:91304375-91304397 CAAACTCCTGGGCTCAAGCAAGG + Intergenic
1118765783 14:68908519-68908541 CCAACTCCAGGTCACCAACTTGG + Intronic
1119228320 14:72960919-72960941 GCAACTCATGCACTCCAGCTTGG - Intergenic
1119509041 14:75196810-75196832 CCCAAGCCTGGTCTCCACCTTGG + Intergenic
1119694452 14:76701595-76701617 CCAGCTCCATGTCCCCAGCTGGG + Intergenic
1121090289 14:91176684-91176706 CCGCCTCCTGGGCTCCAGCGAGG + Intronic
1121101402 14:91253019-91253041 GCAGCCCCTGTTCTCCAGCTGGG + Intronic
1122693376 14:103541786-103541808 CCTCCTCCTGGCCACCAGCTGGG - Intergenic
1122737679 14:103852971-103852993 CCAACTCCTGAGCTCAAGCAAGG - Intergenic
1124414427 15:29463211-29463233 CCAACCCCTGGTTTCCAGCCTGG - Intronic
1124578860 15:30933981-30934003 CAAACTCCTGGGCTCCACGTTGG + Intronic
1125005119 15:34808103-34808125 CCATCTCCTGGCCTCCAAATGGG - Intergenic
1125466814 15:39961236-39961258 CAAATTCCTGGTTTCCAACTGGG - Intronic
1125817288 15:42597285-42597307 TGAACTCCTGGGCTCCACCTTGG + Intronic
1126112435 15:45183614-45183636 CCAAGTCCTGGGCCCCAGCCAGG + Intronic
1126663652 15:51055964-51055986 CCAACCCCTGTTCTCCATATTGG - Intergenic
1127266199 15:57364422-57364444 CCATCACCTGGTTACCAGCTGGG - Intergenic
1129660807 15:77551909-77551931 GCAGGTCCTGCTCTCCAGCTTGG - Intergenic
1129677486 15:77640077-77640099 CCAAGTCCTGGCTTCCTGCTAGG - Intronic
1130228982 15:82082222-82082244 CCAAGTCCTGGTCCACAACTGGG + Intergenic
1132296648 15:100740024-100740046 CAACCTCCTGGTCTCAAGCCGGG - Intergenic
1133198734 16:4189342-4189364 CTTTCTCATGGTCTCCAGCTAGG - Intergenic
1133463941 16:6011798-6011820 CAACCTCCTCGTCTCCAACTTGG - Intergenic
1133926381 16:10196286-10196308 CAAACTCCTGGGCTCAAGCTAGG + Intergenic
1134027762 16:10967484-10967506 TGAACTCCTGGCCTCAAGCTGGG + Intronic
1134744900 16:16580507-16580529 ACAAGTCCTGGCCTCCACCTAGG + Intergenic
1135000584 16:18773262-18773284 ACAAGTCCTGGCCTCCACCTAGG - Intergenic
1138097708 16:54225371-54225393 CGAACTCCTGGGCTCAAGCCAGG - Intergenic
1138260175 16:55614111-55614133 CCAACCTCTGATCTCCTGCTAGG - Intergenic
1138275551 16:55731482-55731504 CTAACTCCTGGGCTCAAGCAAGG - Intergenic
1138352363 16:56352782-56352804 CCACCTCCTGCTCTGCACCTTGG - Intronic
1141181008 16:81753460-81753482 ACAACTACTGCACTCCAGCTTGG - Intronic
1141943788 16:87296381-87296403 CCACCTCCTGCTCCCCACCTGGG + Intronic
1142471409 17:165147-165169 TCAGCTCCTGTTCACCAGCTGGG + Intronic
1142688400 17:1591021-1591043 CCCCCTCCTGGCCTCCAGCGTGG - Intronic
1143952724 17:10646427-10646449 CAGCCTTCTGGTCTCCAGCTTGG - Intronic
1144466526 17:15502002-15502024 GTAACACCTGTTCTCCAGCTGGG - Intronic
1144966375 17:19079169-19079191 CCAAGCCCTGGAGTCCAGCTGGG + Intergenic
1144981543 17:19172888-19172910 CCAAGCCCTGGAGTCCAGCTGGG - Intergenic
1144986681 17:19205351-19205373 CCAAGCCCTGGAGTCCAGCTGGG + Intergenic
1145373659 17:22327925-22327947 CAAACTCCTGGCCTCAAGCAAGG - Intergenic
1145984572 17:29036699-29036721 CCACCTCCTGGTCTGAAGGTGGG + Intronic
1146830410 17:36064269-36064291 ACAACTCCTGGCCTCCTTCTGGG - Exonic
1147722798 17:42549031-42549053 CGAGCTACTGCTCTCCAGCTTGG + Intergenic
1147723862 17:42554590-42554612 CCCACTCCTGGAGTCCAGCCCGG - Intronic
1148429938 17:47634612-47634634 CGAACTCCTGGGCTCAAGCAAGG - Intergenic
1148567621 17:48642848-48642870 CCAACTCCTGGTCACGACTTCGG + Intergenic
1148799584 17:50214919-50214941 GATTCTCCTGGTCTCCAGCTTGG + Intergenic
1148989302 17:51651605-51651627 CCAGCTGCTAGTCACCAGCTCGG + Intronic
1149566375 17:57643440-57643462 CCTACTCCTGGTCCTCTGCTGGG + Intronic
1149748547 17:59122976-59122998 CAAACTCCTGCACTCCAGCCTGG + Intronic
1149817909 17:59744566-59744588 TGAACTCCTGGTCTCAAGCAGGG - Intronic
1151269211 17:72979987-72980009 CCTACACCAGCTCTCCAGCTGGG + Intronic
1151417738 17:73977459-73977481 CCAGCACCTAGTCTCCAGCCAGG - Intergenic
1151571067 17:74925538-74925560 CCCACCCCTGGTTTCCAGGTGGG + Exonic
1151764474 17:76125072-76125094 CCCAGTCCTGGTCTCCACCTGGG - Intergenic
1151879113 17:76884472-76884494 GCCACTGCTGGTCTCCAGCCTGG - Intronic
1152248889 17:79201223-79201245 CTCTCTCCTGGTCTCCAGGTTGG + Intronic
1152376635 17:79921974-79921996 CCAACTCCTGGGCTACAGGAGGG - Intergenic
1153505458 18:5792252-5792274 CCAGCTCCAGGTCTCCAGTTTGG + Intergenic
1153866434 18:9273754-9273776 CCATCTTAAGGTCTCCAGCTGGG + Intronic
1153900097 18:9611068-9611090 TCAAGTCCTAGACTCCAGCTAGG + Intronic
1154219394 18:12438845-12438867 ACAACTCTTGTTCTCCAGCTTGG - Intergenic
1155922760 18:31619596-31619618 CCAAGCCCTTATCTCCAGCTTGG - Intergenic
1156008352 18:32470115-32470137 CCACCTCCTTGTCTGCTGCTGGG + Intronic
1157562717 18:48660063-48660085 CCACCACCTGCTCCCCAGCTGGG + Intronic
1157562760 18:48660315-48660337 CCACCACCTGCTCCCCAGCTGGG + Intronic
1158077022 18:53542811-53542833 CCTCCACCTGGTCCCCAGCTAGG + Intergenic
1158358809 18:56649354-56649376 CGAACTCCTGGCCTCAAGATTGG - Intronic
1158689104 18:59644304-59644326 CCAACTCCTGGGCTGCAGACTGG - Intronic
1161050016 19:2158440-2158462 TCAACTCCTGGGCTCAAGCAGGG + Intronic
1161542377 19:4859821-4859843 CCCACTCTGGGGCTCCAGCTTGG + Exonic
1162559338 19:11406757-11406779 CCAGCTCCTGGACTTCAGCGTGG - Exonic
1162845506 19:13389302-13389324 CCGCCTCCTGGTCTCCAGGAGGG + Intronic
1162871757 19:13591674-13591696 CAAACTGCAGGTCACCAGCTAGG - Intronic
1163498786 19:17663238-17663260 CAACCTGCTTGTCTCCAGCTGGG - Intronic
1163572453 19:18090514-18090536 CCATCTCTTCATCTCCAGCTGGG - Intronic
1164793734 19:31009400-31009422 ACAACTCCTGGGCTCCAGGCTGG + Intergenic
1165081147 19:33307013-33307035 CCAACCACTGCTCTCCAGCCTGG - Intergenic
1165113100 19:33513478-33513500 CCACCTCCTGGCCACCAGCAAGG + Intronic
1165184614 19:34006946-34006968 CCAACTCCTGGGCTCAAGCCTGG - Intergenic
1166349950 19:42192200-42192222 CCAACCCATGCTCTCCTGCTGGG - Intronic
1166650638 19:44571909-44571931 CCTAGGCCTGGCCTCCAGCTGGG - Intergenic
1167012988 19:46821323-46821345 CGAACTACTGAGCTCCAGCTCGG - Intergenic
1167205625 19:48099638-48099660 CCCACCCCAGGTCCCCAGCTGGG + Intronic
1167326326 19:48828394-48828416 CGAACTCCTTGCCTCAAGCTGGG - Intronic
1167348679 19:48962272-48962294 CCCACTCCCATTCTCCAGCTCGG - Intergenic
1168521044 19:57050713-57050735 CCAACTCCTGACCTCCAGGGAGG - Intergenic
925529304 2:4841980-4842002 TCAACTCCTGCTCTGCAGCCTGG + Intergenic
926134913 2:10329751-10329773 CCAGATCCTGGGCTCCAGGTGGG + Intronic
926670451 2:15572733-15572755 TCCACTCCTGGGCTCCACCTCGG + Intergenic
926771089 2:16375930-16375952 ACAACTCCTTGTCTCCAGAAAGG + Intergenic
929641446 2:43583988-43584010 CAAAATCCTGCACTCCAGCTTGG + Intronic
932158354 2:69438294-69438316 CGCACTCCTGCTCTCCAGCCTGG - Intergenic
932461264 2:71883403-71883425 CCCATTCCTAGTCCCCAGCTGGG + Intergenic
933672927 2:85026531-85026553 CAAACTACTGCACTCCAGCTTGG - Intronic
933716465 2:85364922-85364944 TGAACTCCTGGGCTCCAGCTGGG + Intronic
933780029 2:85794976-85794998 CGAAGGCCTGGGCTCCAGCTTGG + Intergenic
936145215 2:109976133-109976155 CCTACTCCTGTTCCCCAGCCCGG - Intergenic
936199470 2:110395345-110395367 CCTACTCCTGTTCCCCAGCCCGG + Intergenic
937095653 2:119233774-119233796 GCAGCTCCTGGCCTCCACCTGGG - Intronic
940645088 2:156383216-156383238 CCAACCCATTGCCTCCAGCTGGG - Intergenic
942235030 2:173895631-173895653 CGAACTCCTGAGCTCAAGCTAGG - Intergenic
942299250 2:174546666-174546688 GCAACTCCTGCCCTCCAGCTTGG - Intergenic
944926598 2:204471668-204471690 CAAACTCCTGGTGTTCAGCAGGG - Intergenic
946077254 2:217084808-217084830 CCACCTCCTGGTGCCCATCTTGG + Intergenic
946078506 2:217096360-217096382 CCATCTCCAGGTATCCAGGTAGG - Intergenic
946289945 2:218737061-218737083 TGAACTCCTGGGCTCAAGCTGGG + Intronic
946426663 2:219602037-219602059 GCAAATCAGGGTCTCCAGCTGGG - Exonic
947186800 2:227462897-227462919 GCACTTCCTGGTCTCGAGCTGGG - Intergenic
947329026 2:229008887-229008909 CCTGCTCCAGGTCTCCATCTTGG + Intronic
947628135 2:231634127-231634149 CCAACTCCTGGGCTCAAGTGCGG - Intergenic
948464867 2:238147591-238147613 CCCACTCCTGAGCTCGAGCTGGG - Intronic
1169222919 20:3836986-3837008 CCCACTCCTAGTCTCCTCCTGGG + Intergenic
1169429650 20:5525235-5525257 CAAACTCCTGGGCTCAAGCGAGG - Intergenic
1170315649 20:15038711-15038733 CCATCACCTGGCCTCCAGGTTGG - Intronic
1170380502 20:15754838-15754860 CAAACTCCTGGGCCCCATCTTGG - Intronic
1171529141 20:25840483-25840505 CAAACTCCTGGCCTCAAGCAAGG + Intronic
1171532916 20:25863878-25863900 TCAACGCATGGTCTCCACCTGGG - Intronic
1171547685 20:26015402-26015424 CAAACTCCTGGCCTCAAGCAAGG - Intergenic
1173741167 20:45403478-45403500 CCTACTCCTGGCCTGCTGCTTGG + Intronic
1174003486 20:47391831-47391853 CGAACTCCTGGGCTCAAGCTGGG + Intergenic
1174472692 20:50772224-50772246 CCACCTCCTGGGTTCAAGCTGGG + Intergenic
1174809176 20:53631266-53631288 CAAACTCCTGGGCTCAAGCCAGG - Intergenic
1175068079 20:56307180-56307202 TCATCCCCTGGTTTCCAGCTGGG - Intergenic
1176043943 20:63082873-63082895 CCAAGTCCTTGTCTCCACCAGGG + Intergenic
1176140723 20:63543586-63543608 CCATCTCAGGGTCCCCAGCTAGG - Intronic
1176905268 21:14493010-14493032 CCAACTGCTGGACTGCTGCTTGG + Intronic
1177207542 21:18027889-18027911 CCACCTCCTGGTCTACAGATGGG - Intronic
1179437029 21:41369228-41369250 TCAGCTCCTGTTCTCCAGCCTGG - Intronic
1179811825 21:43876467-43876489 CCCACTCCTGGACTCCTGGTAGG - Intronic
1179949105 21:44699733-44699755 CAAACTCCAGGTCTCCAACCAGG + Intronic
1180046994 21:45311284-45311306 CCTTCTCCTGTCCTCCAGCTGGG + Intergenic
1180998989 22:19979235-19979257 CCCAGTACTGGTTTCCAGCTAGG + Intronic
1182588624 22:31362004-31362026 CCAACTCCTGGGCTCCCTCCTGG - Intergenic
1183549837 22:38475711-38475733 CCACCTCCTGGTTTCAAGCCGGG + Intronic
1184010425 22:41744096-41744118 CGAACTCCTGACCTCCACCTCGG + Intronic
1184302028 22:43566996-43567018 CCGTCTCCTGGTATCCACCTGGG + Intronic
1184714914 22:46275753-46275775 CCATGTCCTTGTCTCCATCTGGG + Intronic
1185189419 22:49424999-49425021 GCACCTCCTGGTTTTCAGCTGGG + Intronic
950335350 3:12188738-12188760 CCCACTCTTGCTCCCCAGCTCGG + Intronic
950948670 3:16976908-16976930 CAAACTCCTGGTCCCTGGCTGGG + Intronic
951041424 3:17992658-17992680 CTAACTCCTGGTCTACAGCATGG + Intronic
951149432 3:19270556-19270578 CCAAAACCTGGTGTCCAGGTAGG - Intronic
951233222 3:20204028-20204050 CCCACTACTGCACTCCAGCTTGG - Intergenic
952236640 3:31487034-31487056 CCATTCCCTGGTCTCCGGCTTGG - Intergenic
952515619 3:34101970-34101992 CCAAATCCTAATCTCCAGCACGG - Intergenic
953473262 3:43184535-43184557 ACCATTCCTGGTCTCCATCTGGG - Intergenic
954390413 3:50265453-50265475 CCCACCCCTGGCCACCAGCTGGG - Intergenic
955254224 3:57313272-57313294 CAAACTCCTGGTCTCAAGCTGGG - Intronic
956588615 3:70889560-70889582 CCCACTCCTGCTCTCCTGCCAGG - Intergenic
956733448 3:72217687-72217709 CCACCTCCTGGGCTCAAGCGAGG + Intergenic
958437826 3:94119543-94119565 TCAACTCCTGCTGTGCAGCTGGG + Intronic
959220833 3:103517111-103517133 CCATCTACTGGTCTGTAGCTTGG + Intergenic
961655012 3:128436317-128436339 CCCTCTCCTGGGCTGCAGCTTGG + Intergenic
964191866 3:154012674-154012696 CCAAGTCCTGCTGTCCAGCTGGG + Intergenic
969746856 4:9079338-9079360 CACACTCCTGGTCTCAAGCAGGG + Intergenic
970592787 4:17574102-17574124 CCATCTTAGGGTCTCCAGCTGGG - Intergenic
971269559 4:25128388-25128410 TGAACTCCTGGGCTCAAGCTTGG - Intronic
971332186 4:25691177-25691199 CAAACTCCTGGCCTCAAGTTTGG + Intergenic
971474906 4:27063851-27063873 CCCACTGCTGCTCTCCAGCCTGG - Intergenic
974272314 4:59666478-59666500 CCAACACCTGGACTCCATGTTGG - Intergenic
975476659 4:74831341-74831363 CAAACTCCTGGTGGCCATCTTGG + Intergenic
980566829 4:134553197-134553219 CCAACTTCTGGTCTCAAACCAGG + Intergenic
981000962 4:139828884-139828906 CCACCTCCTGGGCTCAAGCGTGG - Intronic
981660232 4:147158094-147158116 GTAACTCCTGGTCTCAAGCAGGG - Intergenic
985137703 4:186803989-186804011 GCAACTCCCTGTCTCCAGATTGG - Intergenic
985555332 5:555326-555348 CCAACCCCTGTTCCACAGCTGGG + Intergenic
988477862 5:31603621-31603643 CCACCTTCTGATCTCCTGCTAGG + Intergenic
990076067 5:51847448-51847470 ACAACTCCTGGGCTCAAGCTGGG - Intergenic
991929310 5:71736513-71736535 CGAACTCCTGGGCTCAAGCAAGG + Intergenic
992103903 5:73434712-73434734 CCAACTCCTAGTGTACATCTTGG - Intergenic
993011428 5:82487972-82487994 CAAACTCCTGAGCTCAAGCTTGG + Intergenic
996722731 5:126646155-126646177 CACACTACTGGACTCCAGCTTGG - Intergenic
997498478 5:134351498-134351520 CAAACTCCTGGGCTCAAGCAAGG + Intronic
997562462 5:134860249-134860271 CAAACTCCTGGTCTCTGGCCAGG + Intergenic
998526520 5:142847823-142847845 CCACCTCCAGGTGTCCAGATGGG - Intronic
998726604 5:145024401-145024423 CCCAGTCCTTGTCTCCAGCCTGG + Intergenic
999738364 5:154530145-154530167 CCAACTTCTGGTCTAGAGGTTGG + Intergenic
1000121584 5:158203132-158203154 AGAACCCCTGCTCTCCAGCTGGG + Intergenic
1002473126 5:179449278-179449300 CCATCTCCTGGGCTGCAGCACGG - Intergenic
1002481098 5:179501376-179501398 CCATCTCCTGGGCTGCAGCACGG + Intergenic
1002514825 5:179749885-179749907 CCAGCGCCTGGTCCCCACCTTGG + Intronic
1003132793 6:3409983-3410005 CTCAATCCTGATCTCCAGCTCGG - Intronic
1004830930 6:19475953-19475975 CCAATTCCTCATCTCCATCTGGG + Intergenic
1006425686 6:33961668-33961690 CCAACTCCTGGGCACCAGTCAGG + Intergenic
1006442861 6:34062979-34063001 CCAGCTCCTGGACTCCAGTAGGG - Intronic
1006879189 6:37324285-37324307 TCAACTCTTAGTCACCAGCTGGG + Intronic
1007358773 6:41341008-41341030 CCACCTCCTGGACTCCAGTTAGG + Intronic
1007610138 6:43143756-43143778 CCAACTCCAGGCTTCCCGCTAGG - Intronic
1007746808 6:44048086-44048108 CCAGGTCCTGGTCCCCAGCAGGG - Intergenic
1009424258 6:63497196-63497218 CAAACTCCTGGCCTCAAGCGAGG + Intergenic
1009979260 6:70707647-70707669 CCCACTACTGCACTCCAGCTTGG - Intronic
1015919069 6:138248601-138248623 CGAACTCCTGACCTCTAGCTAGG - Intronic
1018212321 6:161494283-161494305 CCAACACCTGCTCTCCAGGTAGG + Intronic
1019262534 7:89557-89579 CCACCTGCTGGTCTCCAGCTGGG + Intergenic
1019493387 7:1325301-1325323 CCAACGCCTGGTCTCGGACTTGG + Intergenic
1019659362 7:2215452-2215474 CCAACACCAGGATTCCAGCTCGG - Intronic
1022471612 7:30684989-30685011 CTAATTCCTGGCCTCCAGCTGGG - Intronic
1022832466 7:34081991-34082013 CCAACTAGTGGTCTGGAGCTAGG + Intronic
1023042336 7:36182712-36182734 GGAACTCCTGATCTCCATCTTGG + Intronic
1023133491 7:37027315-37027337 CCAACACCTAGTCCCCAGCAAGG + Intronic
1025149692 7:56538908-56538930 CCACCTCCTGCTCCTCAGCTCGG + Intergenic
1026198250 7:68191615-68191637 CCAACTCCTGGCCACCATCCAGG - Intergenic
1026818811 7:73532830-73532852 CCACCTCCAGGGCTCAAGCTGGG + Intergenic
1026904782 7:74056739-74056761 CCAAGTCCTGCTCTCCCGCGGGG + Intronic
1027006988 7:74703226-74703248 CCAAATCCTGTACTCCAGCCTGG - Intronic
1027797503 7:82712894-82712916 CCAACCCCTTGTTTCCATCTTGG + Intergenic
1028812978 7:95109791-95109813 CCTACTACTGCACTCCAGCTTGG + Intronic
1029147171 7:98454876-98454898 CAAACTCCTGGTCTCAAGCGAGG + Intergenic
1029305659 7:99617692-99617714 CGCACCACTGGTCTCCAGCTGGG + Intronic
1029424001 7:100485538-100485560 CCAACTCCTGCTCTCCTGTGGGG + Intronic
1029530259 7:101120813-101120835 CAAACTCCTGGGCTCAAGGTTGG - Intergenic
1029853950 7:103494416-103494438 CCCACTACTGCACTCCAGCTAGG - Intronic
1030761340 7:113356157-113356179 CCAACTGCTAGACTACAGCTAGG + Intergenic
1031027457 7:116695879-116695901 CCAACTACAGTTCTCTAGCTTGG + Intronic
1032805471 7:135349837-135349859 CAAAATCCTGGCCTCAAGCTGGG + Intergenic
1033404303 7:141057114-141057136 CCACCTCCTGGGCTCAAGCAAGG - Intergenic
1033597174 7:142866375-142866397 CCTACTCCTGATCTCCAGCCTGG + Intronic
1035261326 7:157663364-157663386 CCAACTCCTGGTGTCTCCCTTGG + Intronic
1035771276 8:2148776-2148798 CCGCATCCTGGACTCCAGCTGGG - Intronic
1035977173 8:4325306-4325328 CCAACTACTGGTTTCTTGCTAGG - Intronic
1037260941 8:17007436-17007458 CCAGCTGCTGTTCTCCAGCCTGG + Intergenic
1038282847 8:26181512-26181534 CGGACTCCTGCACTCCAGCTTGG - Intergenic
1038767424 8:30442146-30442168 CGAACTCCTGGGCTCAAGCGTGG + Intronic
1040642994 8:49362435-49362457 CAAACTCCTGGGCTCAAGCTGGG + Intergenic
1040897489 8:52383967-52383989 CAAACTCCTGGGCTCAAGCTAGG + Intronic
1041273403 8:56131910-56131932 CAAACTCCTGGGCTCAAGCCTGG - Intergenic
1041498541 8:58514312-58514334 CCAACCCCTGGGCTGCAGATTGG + Intergenic
1045021743 8:98050875-98050897 CAAACTCCTGGACCCCACCTAGG + Intergenic
1047080547 8:121454789-121454811 GCAACTCCTAAACTCCAGCTGGG - Intergenic
1047504908 8:125471648-125471670 TGAACTCCTGGGCTCAAGCTGGG - Intergenic
1047805297 8:128353205-128353227 CTAACTTCTGGGCACCAGCTGGG + Intergenic
1048106051 8:131411233-131411255 CAATCTCCCGGTCTCCAGCCAGG - Intergenic
1049000004 8:139819016-139819038 TCACCTCCTGCTCTCCAGCCTGG - Intronic
1049299601 8:141862543-141862565 CCTGCTCCTGGCCTTCAGCTGGG + Intergenic
1049763004 8:144339222-144339244 CCCAGTCCTGGGCCCCAGCTAGG + Intergenic
1050494031 9:6220795-6220817 CGAGCTACTGCTCTCCAGCTTGG - Intronic
1051357195 9:16250426-16250448 CCAACACCTGGGACCCAGCTTGG + Intronic
1054185539 9:61948798-61948820 CAAACTCCTGGCCTCAAGCAAGG + Intergenic
1054467813 9:65509245-65509267 CAAACTCCTGGCCTCAAGCAAGG - Intergenic
1054652973 9:67639694-67639716 CAAACTCCTGGCCTCAAGCAAGG - Intergenic
1054757676 9:68975663-68975685 CAAACTCCTGGCCTCCAGAACGG - Intronic
1056231562 9:84550789-84550811 CGAACTCCTGGTCTCAAGCAAGG + Intergenic
1056765782 9:89443646-89443668 CCAGGTCCTGGCCACCAGCTCGG - Intronic
1057026701 9:91739460-91739482 CAAACTACTGGGCTCCAGCCTGG + Intronic
1057265325 9:93613644-93613666 CAAACTCCTGGGCTCAAGCAAGG + Intronic
1057975546 9:99602251-99602273 CCAACTCCTCGTCTCCATAATGG + Intergenic
1059190248 9:112318714-112318736 CCCACTACTGCTCTCCAGCCTGG + Intronic
1060764338 9:126282740-126282762 CCAACTCAGGCTCACCAGCTCGG - Intergenic
1061053874 9:128211565-128211587 CAAACTCCTGGCCTCAAGCTGGG + Intronic
1061086901 9:128404820-128404842 CCTACTCTTTGTCTCCAGATTGG - Intergenic
1061213170 9:129205052-129205074 CAAACTCCTGGGCCCCACCTTGG - Intergenic
1061390326 9:130314164-130314186 ACATCTCCTGTTCCCCAGCTCGG - Intronic
1061550758 9:131333432-131333454 CCAACTAGTGCACTCCAGCTTGG + Intergenic
1062516461 9:136939434-136939456 CCAACTCCTGGTCTCCAGCTGGG - Intronic
1186165902 X:6825588-6825610 CCACCTCTAAGTCTCCAGCTTGG + Intergenic
1190130044 X:47739671-47739693 CCACCTCCTGGGTTCGAGCTGGG + Intergenic
1190833170 X:54077456-54077478 CAAACTCTTGGCCTCAAGCTGGG - Intronic
1192528032 X:71864431-71864453 GGAACTCCTGAGCTCCAGCTGGG - Intergenic
1192713336 X:73615312-73615334 CCAATTCTTGGTCTCCAGTCAGG + Intronic
1195242280 X:102964201-102964223 CCAAATTCTGTTCTCCAGGTTGG - Intergenic
1195420255 X:104667506-104667528 CCAACTCTTGTTCTCCATATAGG + Intronic
1195783612 X:108491654-108491676 CCACCCCCTGCTCTCTAGCTTGG + Intronic