ID: 1062516463

View in Genome Browser
Species Human (GRCh38)
Location 9:136939435-136939457
Sequence GCCAACTCCTGGTCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062516463_1062516468 1 Left 1062516463 9:136939435-136939457 CCAGCTGGAGACCAGGAGTTGGC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062516468 9:136939459-136939481 GGGCAGAGGCTCCGTCCCTCTGG No data
1062516463_1062516475 23 Left 1062516463 9:136939435-136939457 CCAGCTGGAGACCAGGAGTTGGC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG No data
1062516463_1062516469 2 Left 1062516463 9:136939435-136939457 CCAGCTGGAGACCAGGAGTTGGC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062516469 9:136939460-136939482 GGCAGAGGCTCCGTCCCTCTGGG No data
1062516463_1062516474 20 Left 1062516463 9:136939435-136939457 CCAGCTGGAGACCAGGAGTTGGC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062516474 9:136939478-136939500 CTGGGTGGCGCAGCCTCTCTCGG No data
1062516463_1062516470 5 Left 1062516463 9:136939435-136939457 CCAGCTGGAGACCAGGAGTTGGC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062516470 9:136939463-136939485 AGAGGCTCCGTCCCTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062516463 Original CRISPR GCCAACTCCTGGTCTCCAGC TGG (reversed) Intronic
900174287 1:1284975-1284997 CCCCACTCCTCGTCTCCACCTGG - Intronic
901473762 1:9475181-9475203 GACGACTTCTGGTCCCCAGCAGG - Intergenic
903787259 1:25869730-25869752 GCAAAATCCTGGTCTAAAGCAGG + Intronic
904103451 1:28054636-28054658 TCGAACTCCTGGGCTCAAGCAGG - Intronic
905652898 1:39668394-39668416 GCCAAGTCCTGGGCTCCCTCTGG + Intronic
906808368 1:48801948-48801970 GACATCCCTTGGTCTCCAGCTGG + Intronic
906891913 1:49725768-49725790 TCCATCTCCTGGGCTCAAGCAGG + Intronic
909377483 1:74956864-74956886 GTCAACTCCATGTCTTCAGCAGG - Intergenic
910058873 1:83064752-83064774 TCCAACTCCAGGTCTCCTACCGG - Intergenic
910586296 1:88883575-88883597 CTCAACTCCTGGGCTCAAGCAGG - Intronic
911057385 1:93720560-93720582 CCCAACTTCGGGTCTCCATCAGG - Intronic
911747461 1:101455211-101455233 CCCAACAGCTGATCTCCAGCAGG + Intergenic
915283911 1:154840992-154841014 GCCTGCCCCTGGTCTCCACCTGG - Intronic
915983589 1:160440426-160440448 CTCAACTCCTGGGCTCAAGCAGG + Intergenic
916043910 1:160983826-160983848 TCAAACTCCTGGGCTCCAGCGGG + Intergenic
916120285 1:161523474-161523496 CCTGAGTCCTGGTCTCCAGCTGG + Intronic
916610158 1:166383907-166383929 GCCAAACCCAGGTCTCCAGTGGG - Intergenic
916747811 1:167697788-167697810 CCTCACTGCTGGTCTCCAGCTGG - Exonic
917929138 1:179811948-179811970 CCCAAGTCCAGGTCTCCAGCTGG - Intronic
917931992 1:179828938-179828960 GCCACTTCCAGGTTTCCAGCTGG - Intergenic
919884871 1:201925932-201925954 TCGAACTCCTGGGCTCAAGCAGG + Intronic
921250561 1:213293584-213293606 TCAAACTCCTGGGCTCAAGCAGG - Intergenic
922316973 1:224451166-224451188 GCCACATCATGGTCTCCTGCAGG - Intronic
922743887 1:228032199-228032221 GCTTCCTCCTGGCCTCCAGCTGG - Intronic
923681108 1:236119443-236119465 TCGAACTCCTGGACTCAAGCAGG + Intergenic
1062794115 10:329963-329985 GCCAGCTCCTGTTCTGAAGCTGG - Intronic
1063163387 10:3437487-3437509 GGGAGCTCCTGGTCCCCAGCAGG - Intergenic
1063333457 10:5185775-5185797 ACTCCCTCCTGGTCTCCAGCGGG + Intergenic
1063859653 10:10293668-10293690 GCCAACGTCCTGTCTCCAGCAGG - Intergenic
1065739229 10:28781943-28781965 TCCACCTCCTGGGCTCAAGCGGG - Intergenic
1067549897 10:47226940-47226962 TCCAGCCTCTGGTCTCCAGCTGG - Intergenic
1070393689 10:75993123-75993145 GCAAACTACTGGTCTCCTCCTGG + Intronic
1070653798 10:78256878-78256900 GCCAAATCCTGGCCCCCAGAAGG - Intergenic
1071672260 10:87619481-87619503 CCCAACTCCTGGACTCAAGTGGG - Intergenic
1071872541 10:89811173-89811195 CCCATTTCCTGGTCTCCAGTTGG + Intergenic
1072506849 10:96076360-96076382 TCAAACTCCTGGGCTCAAGCAGG - Intergenic
1073064454 10:100749962-100749984 GCCAGCCCTGGGTCTCCAGCTGG + Intronic
1073318093 10:102596934-102596956 GCCAGCTCCTGGACTCCTCCAGG - Intronic
1073800870 10:107039973-107039995 GTCAACTCCTGGACTTAAGCAGG - Intronic
1074411854 10:113235479-113235501 CCCAAATCCTGATGTCCAGCAGG - Intergenic
1075158123 10:119997678-119997700 GGCAACTCCTGTTCCACAGCAGG + Intergenic
1075710035 10:124525948-124525970 GCCACCTCCCGGCCTCCACCTGG - Intronic
1076154711 10:128194770-128194792 TCCAATTCCTGCTCTCCAGAGGG - Intergenic
1076577213 10:131477323-131477345 GCCTCTTCCTGGTTTCCAGCCGG - Intergenic
1076769751 10:132656525-132656547 GCTGACTCCTTGACTCCAGCTGG - Intronic
1076873158 10:133203313-133203335 CCAAACTCATGGTGTCCAGCAGG + Intronic
1077173245 11:1177664-1177686 CCCACCTCCAGGTTTCCAGCCGG - Intronic
1077325228 11:1960881-1960903 CCCATCTTCTGGCCTCCAGCAGG + Intronic
1077420036 11:2445729-2445751 GCCAAATTCTGGGCTCCAGGTGG - Intronic
1077423813 11:2465242-2465264 GCGACCTCCTGGGCTCAAGCTGG + Intronic
1078053325 11:7986148-7986170 GTCAAGTCCTAGTGTCCAGCTGG - Intronic
1079210643 11:18457755-18457777 TCAAACTCCTGGCCTCAAGCAGG + Intronic
1080632794 11:34094575-34094597 TCAAACTCCTGGTCTCAAGTGGG - Intronic
1083151439 11:60794194-60794216 GCCCACACCTGGGCTCCAGGAGG - Intronic
1083319075 11:61834355-61834377 GCAAAGTCCTGGGCTCCAGGTGG - Intronic
1083827512 11:65211800-65211822 GGCAGCTCCTGGTCGGCAGCAGG - Exonic
1084311231 11:68317407-68317429 CCCACCTCCTGGTCCCCATCTGG - Intronic
1084764784 11:71301294-71301316 TTCAACTTCTGGCCTCCAGCCGG - Intergenic
1085616855 11:78006808-78006830 TCCAACTCCTGGGCTCAAGCAGG - Intergenic
1090084733 11:123641119-123641141 GCCCTCTCCTGGTCACCATCTGG - Intronic
1090645673 11:128765020-128765042 GCACACACCTGCTCTCCAGCTGG - Intronic
1202808209 11_KI270721v1_random:16060-16082 CCCATCTTCTGGCCTCCAGCAGG + Intergenic
1091979292 12:4852736-4852758 CCCACCTCCTGCTCTCCTGCTGG - Intergenic
1092197154 12:6556253-6556275 GCCACCGCCTGGACTCCAGCCGG + Intergenic
1093270009 12:17048830-17048852 GCCTACTCCTGGACTTCAGTTGG + Intergenic
1093648096 12:21611818-21611840 GCCAACTGATGGTCTCCTGCAGG - Intergenic
1096340539 12:50794697-50794719 TCAAACTCCTGGGCTCAAGCAGG - Intronic
1096657068 12:53098367-53098389 GCCATCCCATGGGCTCCAGCAGG + Intronic
1096850390 12:54431997-54432019 ACCAACTGCTGGTCAGCAGCAGG + Intergenic
1096864332 12:54552781-54552803 GCCAACTCATCATCTCCAGATGG - Intronic
1097119999 12:56724472-56724494 GGCAACTCCTGCTCTGTAGCAGG + Exonic
1099709054 12:86196441-86196463 GCCACCTCCTGGGTTTCAGCAGG - Intronic
1100508264 12:95242517-95242539 TCAAACTCCTGGGCTCAAGCAGG + Intronic
1100681070 12:96921742-96921764 CCCAACTCCTGGGCTCAAGTGGG + Intronic
1102017242 12:109656067-109656089 GCAAACTCCTGGGCCCCACCCGG + Intergenic
1102796126 12:115690291-115690313 TTGAACTCCTGGCCTCCAGCTGG - Intergenic
1103379785 12:120485129-120485151 TCAAACTCCTGGGCTCAAGCAGG - Intronic
1103402045 12:120649706-120649728 GCCATCTCCTGGTTTCCTTCGGG + Intronic
1105708138 13:22981554-22981576 GCCACCCCCTAGTCTGCAGCTGG + Intergenic
1105805294 13:23948694-23948716 GCCATGTCCTTGTCTCCAGAGGG + Intergenic
1106578543 13:30998602-30998624 GCCAGCTCCTGATCTGAAGCAGG + Intergenic
1107864755 13:44692918-44692940 GCCAACAGCTGGGCTCCCGCAGG + Intergenic
1111620484 13:90718486-90718508 GCCCACTCCTGTTCAACAGCAGG - Intergenic
1113156311 13:107326844-107326866 GCCAGATCCTGGTCTCCACTGGG + Intronic
1113156326 13:107326919-107326941 GCCAGATCCTGGTCTCCACTGGG + Intronic
1113877540 13:113603940-113603962 TCGAACTCCTGGGCTCAAGCAGG - Intronic
1114463320 14:22902237-22902259 TCCAGCTCCTGGTCCCCATCAGG + Exonic
1115822906 14:37231306-37231328 TCAAACTCCTGGCCTCAAGCAGG + Intronic
1116569858 14:46502644-46502666 GCCTACTGCTGGTCTGCAGTAGG + Intergenic
1119694450 14:76701594-76701616 GCCAGCTCCATGTCCCCAGCTGG + Intergenic
1121011017 14:90520418-90520440 CCAGACTCCTGGGCTCCAGCAGG + Intergenic
1121144127 14:91568780-91568802 GCCAACCCCAGGTCTCCTGCAGG - Intergenic
1121328574 14:93035758-93035780 GCCACCTCCTGGTACCCAGGAGG - Intronic
1122121363 14:99555221-99555243 GCCAACTCCTGGTCTCAACAGGG + Intronic
1122673566 14:103390929-103390951 TCTAACTCCTGGGCTCAAGCAGG + Intronic
1127418722 15:58783732-58783754 ACAAACTCCTGGACTCAAGCAGG - Intronic
1128138220 15:65279984-65280006 ACAAACTCCTGGTCTCAAGCAGG - Intronic
1129458268 15:75687263-75687285 TCCAACTCCTCACCTCCAGCTGG + Exonic
1130959272 15:88649002-88649024 TCCGACTCCTGGGCTCCAGCAGG + Intronic
1132296649 15:100740025-100740047 TCAACCTCCTGGTCTCAAGCCGG - Intergenic
1132578879 16:676170-676192 GCCAGCTCCTGGGATCAAGCAGG + Intronic
1133780621 16:8936252-8936274 GCCAACACCTGGTCTCTGGGTGG + Intronic
1137350680 16:47711724-47711746 GCCATGTCCAGGTCTCCAGTGGG + Intergenic
1137483294 16:48870310-48870332 GCCTGGGCCTGGTCTCCAGCAGG + Intergenic
1137597608 16:49735229-49735251 TCCCACTCCTGATCTCCAGCAGG + Intronic
1137795181 16:51211286-51211308 GCCAACTCCTGGAAAACAGCAGG + Intergenic
1139752164 16:69115534-69115556 GCCTCCTCCTGGGCTCCAGAGGG + Exonic
1139961575 16:70721159-70721181 GCCCACTTCTGGTCTGTAGCCGG - Intronic
1140876295 16:79155592-79155614 GCCAATCCCTCATCTCCAGCAGG + Intronic
1141147672 16:81543061-81543083 GCCACCTCATGGGCTCCAGCGGG - Intronic
1141298038 16:82788332-82788354 GCCATCTCCTGGGCACCTGCTGG - Intronic
1142163129 16:88569802-88569824 GCCGGCCCCTGGTCTCCGGCCGG + Intergenic
1142719101 17:1764379-1764401 GCCTACAGCTGGTCTCCACCCGG - Intronic
1144161920 17:12568384-12568406 ACCATCTCCTGGTGTCCAGCTGG + Intergenic
1144341153 17:14311297-14311319 TCAAACTCCTGGGCTCAAGCAGG + Intronic
1144466527 17:15502003-15502025 GGTAACACCTGTTCTCCAGCTGG - Intronic
1144966373 17:19079168-19079190 GCCAAGCCCTGGAGTCCAGCTGG + Intergenic
1144981545 17:19172889-19172911 GCCAAGCCCTGGAGTCCAGCTGG - Intergenic
1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG + Intergenic
1145274472 17:21421602-21421624 GCCCAGCCCTGGTCACCAGCAGG - Intergenic
1145312329 17:21707501-21707523 GCCCAGCCCTGGTCACCAGCAGG - Intergenic
1147406797 17:40218247-40218269 GCCATCTCCTGGTGTTTAGCAGG + Intergenic
1148331228 17:46815070-46815092 GTGAGCTCCTGATCTCCAGCAGG + Intronic
1148354186 17:46964435-46964457 GCCATGTTCTGTTCTCCAGCAGG - Intronic
1149817910 17:59744567-59744589 TTGAACTCCTGGTCTCAAGCAGG - Intronic
1150018971 17:61591131-61591153 GGCAACTCCTGCTCTGTAGCAGG + Exonic
1150837473 17:68577412-68577434 GCGAACCACTGGTCTACAGCAGG - Intronic
1151316463 17:73325441-73325463 GTAAACTCCCGGACTCCAGCGGG - Intergenic
1151764476 17:76125073-76125095 CCCCAGTCCTGGTCTCCACCTGG - Intergenic
1152376637 17:79921975-79921997 CCCAACTCCTGGGCTACAGGAGG - Intergenic
1153252184 18:3134078-3134100 TCAAACTCCTGGGCTCAAGCAGG + Intronic
1153659145 18:7311085-7311107 ACCCACTCTTGGTATCCAGCAGG + Intergenic
1156601334 18:38610713-38610735 TCGAACTCCTGGGCTCAAGCAGG + Intergenic
1160451758 18:78971212-78971234 GCCACCTCCTGCTCTCCAGCAGG - Intergenic
1160737521 19:670691-670713 GCCAACCCCTGGGCTCCAGGAGG - Intergenic
1161050015 19:2158439-2158461 CTCAACTCCTGGGCTCAAGCAGG + Intronic
1161573295 19:5041797-5041819 GCCCACTTCTGGCGTCCAGCGGG - Intronic
1162845504 19:13389301-13389323 GCCGCCTCCTGGTCTCCAGGAGG + Intronic
1163739661 19:19003695-19003717 GCCATCTCCTGCTCTCCTGTGGG - Intronic
1163799772 19:19357271-19357293 GCCATCTCTGGGTCTCCAGGGGG + Exonic
1165134561 19:33659607-33659629 TCCAACTCCTGGGCTCAAGCAGG - Intronic
1167018568 19:46857934-46857956 TCAAACTCCTGGCCTCAAGCAGG - Intergenic
925546402 2:5021643-5021665 CCACACTGCTGGTCTCCAGCTGG - Intergenic
927032865 2:19140744-19140766 GCCAGCTGCTGGCCTCCAACAGG - Intergenic
927521920 2:23704060-23704082 CCCAACCCCGGGGCTCCAGCTGG + Intronic
927776720 2:25909546-25909568 CCCAACTCCTGGGCTCAAGGAGG - Intergenic
929186920 2:39105343-39105365 TCAAACTCCTGGCCTCAAGCTGG + Intronic
930429117 2:51251450-51251472 GCCAACTCCTGCCCTGCAACTGG + Intergenic
931668727 2:64627964-64627986 CCTAACTCCTGGTCTACTGCTGG + Intergenic
932024154 2:68116678-68116700 CCCTCCTCATGGTCTCCAGCGGG + Intergenic
933716464 2:85364921-85364943 TTGAACTCCTGGGCTCCAGCTGG + Intronic
934553705 2:95276787-95276809 GGCCACTCTTGCTCTCCAGCCGG - Intronic
934619302 2:95794218-95794240 GCCAACACCCGCTCTCCAGAAGG - Intergenic
934641590 2:96030339-96030361 GCCAACACCCGCTCTCCAGAAGG + Intronic
936127547 2:109802408-109802430 GCCAGCTGCTGCACTCCAGCCGG - Intronic
936217150 2:110569077-110569099 GCCAGCTGCTGCACTCCAGCCGG + Intronic
936426290 2:112423661-112423683 GCCAGCTGCTGCACTCCAGCCGG + Intronic
940376251 2:152962436-152962458 GTCCAGTGCTGGTCTCCAGCAGG - Intergenic
944926599 2:204471669-204471691 GCAAACTCCTGGTGTTCAGCAGG - Intergenic
946309942 2:218877893-218877915 GCCCAGTCCTGGTGCCCAGCTGG - Intergenic
947186801 2:227462898-227462920 GGCACTTCCTGGTCTCGAGCTGG - Intergenic
1170173025 20:13436462-13436484 GCCAACTCCTGATCTAGAACAGG + Intronic
1171205679 20:23278939-23278961 GGCATCCCATGGTCTCCAGCTGG - Intergenic
1171532917 20:25863879-25863901 GTCAACGCATGGTCTCCACCTGG - Intronic
1172808950 20:37633447-37633469 GCCCACCCCTGGTCTCCAAGAGG + Intergenic
1173449474 20:43150181-43150203 GCAAACTCCTTGGCTCCAGCCGG - Intronic
1174003485 20:47391830-47391852 TCGAACTCCTGGGCTCAAGCTGG + Intergenic
1174500291 20:50979306-50979328 TCAAACTCCTGGCCTCAAGCGGG - Intergenic
1175606352 20:60314988-60315010 TTGAACTCCTGGTCTCCTGCAGG - Intergenic
1176043941 20:63082872-63082894 TCCAAGTCCTTGTCTCCACCAGG + Intergenic
1177207544 21:18027890-18027912 ACCACCTCCTGGTCTACAGATGG - Intronic
1178583547 21:33855349-33855371 GACAACCACTGGTCCCCAGCAGG + Intronic
1179892922 21:44346082-44346104 GCCGACACCTGGTCTAGAGCAGG - Intergenic
1181810413 22:25400640-25400662 CCCACCTCCTGGTCCCCATCTGG + Intronic
1182427636 22:30283317-30283339 GCCAGCTCTTCGCCTCCAGCAGG - Intergenic
1182772301 22:32804313-32804335 GCCAAGTACTGGACGCCAGCAGG - Intronic
1183208079 22:36433049-36433071 CCCTACTCCAGGTCTCCACCAGG + Intergenic
1183549835 22:38475710-38475732 TCCACCTCCTGGTTTCAAGCCGG + Intronic
1184407997 22:44311129-44311151 CCCAACTCCAGGGCTCCAGTGGG + Intronic
1185306543 22:50120803-50120825 GCCAGCCCCTGGTGTACAGCAGG - Intronic
950739333 3:15037289-15037311 TCAAACTCCTGGCCTCAAGCAGG + Intronic
952762074 3:36923731-36923753 GGCAACTGCAGGTCTCCGGCAGG + Intronic
955254225 3:57313273-57313295 TCAAACTCCTGGTCTCAAGCTGG - Intronic
955326548 3:58013082-58013104 GCCAACTCCTGGCAAACAGCTGG - Intronic
956345273 3:68271275-68271297 CCCAACTCCTGCTTCCCAGCTGG + Intronic
956844307 3:73168334-73168356 GCCACCCCCTGTTCTACAGCTGG + Intergenic
961035393 3:123638240-123638262 GGCAGCTGCTGGTCTCAAGCTGG - Intronic
962195475 3:133358946-133358968 GCCAACTCCTGATCTAGAGATGG - Intronic
964191864 3:154012673-154012695 ACCAAGTCCTGCTGTCCAGCTGG + Intergenic
964504288 3:157381495-157381517 GCAAACTCCTGTTCTCGATCAGG - Intronic
965098629 3:164269266-164269288 TCCACCTCCTGGGCTCAAGCAGG + Intergenic
966399567 3:179534709-179534731 TCCAACCCCTGGTTTCCAGCTGG + Intergenic
967997583 3:195178511-195178533 GCAAACTCAGTGTCTCCAGCAGG + Intronic
968689735 4:1984341-1984363 GCCAGCTGCTGGCCTGCAGCAGG + Intronic
969746855 4:9079337-9079359 TCACACTCCTGGTCTCAAGCAGG + Intergenic
970752961 4:19387637-19387659 GCCAGCTCTTGGGCCCCAGCAGG - Intergenic
973615966 4:52678142-52678164 GTAAATTCCTGGTCTCCACCTGG - Intergenic
975703641 4:77090522-77090544 CTCAACTCCTGGGCTCAAGCAGG + Intergenic
978848283 4:113301649-113301671 TCCAACACCTGGTCACCACCAGG + Intronic
981660233 4:147158095-147158117 TGTAACTCCTGGTCTCAAGCAGG - Intergenic
983209408 4:164943317-164943339 GGCAACTCCTGCTCTGTAGCAGG - Intergenic
986285576 5:6356021-6356043 GCCAACCCCTTGCCTCCAGGAGG - Intergenic
987551344 5:19385674-19385696 GCCAACTTATGTTCTCCAGATGG + Intergenic
990076068 5:51847449-51847471 TACAACTCCTGGGCTCAAGCTGG - Intergenic
991198481 5:63961940-63961962 GCCAACTCCAGTTTCCCAGCTGG - Exonic
993536776 5:89096023-89096045 GCCAACTCCTCTTCTTCAGGTGG + Intergenic
1000454528 5:161433377-161433399 TCAAACTCCTGGGCTCAAGCAGG - Intronic
1000826238 5:166047945-166047967 GTCAACTCCAGCTTTCCAGCTGG + Intergenic
1001422235 5:171596680-171596702 GCCAACTCCTGGCCGCCTGAAGG + Intergenic
1004513139 6:16298601-16298623 TCGAACTCCTGGGCTCAAGCAGG + Intergenic
1005582667 6:27249177-27249199 GCCATTTCCAGGCCTCCAGCAGG - Exonic
1006442863 6:34062980-34063002 TCCAGCTCCTGGACTCCAGTAGG - Intronic
1006879188 6:37324284-37324306 GTCAACTCTTAGTCACCAGCTGG + Intronic
1007433059 6:41787459-41787481 CCCACCTCCGGCTCTCCAGCCGG - Intronic
1007746810 6:44048087-44048109 TCCAGGTCCTGGTCCCCAGCAGG - Intergenic
1010141554 6:72620458-72620480 GCCTGCTCCTGGTCACCAGCAGG - Intergenic
1014550829 6:122788346-122788368 ACAAACTGCTGGGCTCCAGCAGG + Intergenic
1016481062 6:144482290-144482312 GTCAACTCCTGGCCACCAGAGGG - Exonic
1017723047 6:157257850-157257872 TCCAACTCCTGATCACCCGCAGG - Intergenic
1019262532 7:89556-89578 CCCACCTGCTGGTCTCCAGCTGG + Intergenic
1019476571 7:1247386-1247408 GCCGCCTGCGGGTCTCCAGCAGG - Intergenic
1021574174 7:22092535-22092557 GACATTTCCTGGTCTCCAGGAGG - Intergenic
1022105655 7:27194830-27194852 GCCAACAGCAGCTCTCCAGCCGG - Intronic
1022471613 7:30684990-30685012 CCTAATTCCTGGCCTCCAGCTGG - Intronic
1022788821 7:33665879-33665901 CCCAAGCCCTGGTTTCCAGCAGG - Intergenic
1022801047 7:33777647-33777669 GCCATCTCCTGATCTCCTGTGGG + Intergenic
1023918172 7:44606426-44606448 GCAAACAGCTGGGCTCCAGCTGG + Intergenic
1024081896 7:45863262-45863284 GCCCACTCAAGGTCTGCAGCTGG + Intergenic
1024553635 7:50584419-50584441 GCCAGCACCTGGTCTCCCACTGG - Intergenic
1026904780 7:74056738-74056760 CCCAAGTCCTGCTCTCCCGCGGG + Intronic
1029423999 7:100485537-100485559 CCCAACTCCTGCTCTCCTGTGGG + Intronic
1033388948 7:140907646-140907668 TCAAACTCCTGGGCTCAAGCGGG + Intronic
1035579672 8:731818-731840 GCCCACTCCTTGTATCCAGCAGG - Intronic
1035749079 8:1983120-1983142 TCCAACTCATGGCCTCTAGCAGG - Intronic
1037257592 8:16972808-16972830 GTCAAGGGCTGGTCTCCAGCAGG - Intergenic
1037391938 8:18402583-18402605 GCCACATCCTAGTCTCCAGGGGG - Intergenic
1040642993 8:49362434-49362456 TCAAACTCCTGGGCTCAAGCTGG + Intergenic
1047080548 8:121454790-121454812 GGCAACTCCTAAACTCCAGCTGG - Intergenic
1047201880 8:122774052-122774074 CCCCACTCCTGGTTTCCAGGAGG - Intergenic
1047913432 8:129555759-129555781 GGCAGCTCCTGGGCTCAAGCAGG + Intergenic
1048025846 8:130586035-130586057 GACCACTCCTGGTATCCACCAGG + Intergenic
1049299599 8:141862542-141862564 GCCTGCTCCTGGCCTTCAGCTGG + Intergenic
1049590386 8:143457644-143457666 TCAAACTCCTGGCCTCAAGCAGG - Intronic
1049667433 8:143852506-143852528 GCCTCCTCCCAGTCTCCAGCCGG + Intergenic
1049693925 8:143974561-143974583 GCCCTCTCCTGGCCTCCCGCAGG + Intronic
1050523287 9:6524062-6524084 CTCAACTCCTGGCCTCAAGCAGG - Intergenic
1056795931 9:89659009-89659031 GATTACTCCTGATCTCCAGCGGG + Intergenic
1057631821 9:96725404-96725426 GACAACTCTAGGTCTCCTGCTGG + Intergenic
1057959867 9:99444800-99444822 GCTAACTCCTGCTCCCCATCAGG + Intergenic
1058956352 9:109952249-109952271 GCCAACCCCTGGCCTCAAACAGG + Intronic
1059332267 9:113543013-113543035 GCCCAACCCTGGGCTCCAGCTGG - Intronic
1060824586 9:126680652-126680674 GCCCTCTCCTGGTCTGCAGTAGG - Intronic
1061053873 9:128211564-128211586 TCAAACTCCTGGCCTCAAGCTGG + Intronic
1061952617 9:133944779-133944801 GCTGACTCCTGGGCCCCAGCTGG + Intronic
1062516463 9:136939435-136939457 GCCAACTCCTGGTCTCCAGCTGG - Intronic
1188606541 X:32038386-32038408 GCCAACTCCTGTTTTCCTGATGG - Intronic
1189386051 X:40537806-40537828 GCCAACTCGTGGTGTCAAGATGG - Intergenic
1191594571 X:62929042-62929064 GCCAACTGGTTGGCTCCAGCTGG - Intergenic
1193214887 X:78852274-78852296 GCCATCTCCAGTTCTTCAGCTGG + Intergenic
1193814145 X:86085108-86085130 CCAAACTCCTGGATTCCAGCTGG - Intergenic
1194917059 X:99719866-99719888 GACTACTCCAGGTTTCCAGCTGG - Intergenic
1195196501 X:102502335-102502357 CCTAACTCTTTGTCTCCAGCAGG + Intergenic
1199857440 X:151771868-151771890 GCCAACTCCTGGGCCCTAGAAGG + Intergenic
1200283867 X:154802307-154802329 GCCTACTCCAGGTCTGCTGCTGG - Intronic
1202101318 Y:21310508-21310530 CCCAAACCCTGGTCTCCAACCGG - Intergenic
1202187199 Y:22197668-22197690 CCCAAACCCTGGTCTCCAACCGG - Intergenic
1202204161 Y:22388728-22388750 CCCAAACCCTGGTCTCCAACCGG + Intronic
1202241060 Y:22770551-22770573 CCCAAACCCTGGTCTCCAACCGG + Intergenic
1202394046 Y:24404294-24404316 CCCAAACCCTGGTCTCCAACCGG + Intergenic
1202476739 Y:25265798-25265820 CCCAAACCCTGGTCTCCAACCGG - Intergenic