ID: 1062516467

View in Genome Browser
Species Human (GRCh38)
Location 9:136939446-136939468
Sequence GCCTCTGCCCTGCCAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 14, 3: 67, 4: 500}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062516467_1062516475 12 Left 1062516467 9:136939446-136939468 CCAGGAGTTGGCAGGGCAGAGGC 0: 1
1: 0
2: 14
3: 67
4: 500
Right 1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG No data
1062516467_1062516474 9 Left 1062516467 9:136939446-136939468 CCAGGAGTTGGCAGGGCAGAGGC 0: 1
1: 0
2: 14
3: 67
4: 500
Right 1062516474 9:136939478-136939500 CTGGGTGGCGCAGCCTCTCTCGG No data
1062516467_1062516469 -9 Left 1062516467 9:136939446-136939468 CCAGGAGTTGGCAGGGCAGAGGC 0: 1
1: 0
2: 14
3: 67
4: 500
Right 1062516469 9:136939460-136939482 GGCAGAGGCTCCGTCCCTCTGGG No data
1062516467_1062516468 -10 Left 1062516467 9:136939446-136939468 CCAGGAGTTGGCAGGGCAGAGGC 0: 1
1: 0
2: 14
3: 67
4: 500
Right 1062516468 9:136939459-136939481 GGGCAGAGGCTCCGTCCCTCTGG No data
1062516467_1062516470 -6 Left 1062516467 9:136939446-136939468 CCAGGAGTTGGCAGGGCAGAGGC 0: 1
1: 0
2: 14
3: 67
4: 500
Right 1062516470 9:136939463-136939485 AGAGGCTCCGTCCCTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062516467 Original CRISPR GCCTCTGCCCTGCCAACTCC TGG (reversed) Intronic
900579009 1:3398950-3398972 GCCTCTGCCCTGCCGTCCCGGGG + Intronic
900640421 1:3685698-3685720 GCCCCTGGCCCGCTAACTCCAGG + Intronic
901279643 1:8024022-8024044 GCCTATGCCATTCCAATTCCTGG + Intronic
901593441 1:10365979-10366001 GCCTCAGCCCTGCAAAGTGCTGG - Intronic
901842226 1:11960935-11960957 GCCTCTGTCCTGCCAACCCCCGG + Intronic
901884447 1:12213011-12213033 GCCTCAGCCCTGCAAAGTGCTGG - Intergenic
901954539 1:12774894-12774916 GACTCTGCTCAGCCAGCTCCAGG - Exonic
901962902 1:12841309-12841331 GGCTCTGCCCTGCCAGCTCCAGG + Intergenic
901967940 1:12883340-12883362 GGCTCCGCCCTGCAAGCTCCAGG + Exonic
901972267 1:12917719-12917741 GCCTCTGCCTTGCCAGCTCCAGG - Exonic
901975746 1:12942470-12942492 GGCTCCGCCCTGCAAGCTCCAGG + Exonic
901980340 1:13029390-13029412 GGCTCTGCCCCGCCAGCTCCAGG - Intronic
901989096 1:13097923-13097945 GACTCTGCCCCGCCAGCTCCAGG + Intergenic
901990091 1:13105615-13105637 GGCTCTGCCCTGCCAGCTCCAGG + Intergenic
901992717 1:13128844-13128866 GACTCTGCCCCGCCAGCTCCAGG - Intergenic
901998748 1:13175313-13175335 GGCTCCGCCCCGCCAGCTCCAGG - Intergenic
902001747 1:13199541-13199563 GGCTCTGCCCCGCCAGCTCCAGG + Intergenic
902005162 1:13226058-13226080 GGCTCTGCCCTGCCAGCTCCAGG + Intergenic
902007755 1:13245889-13245911 GGCTCTGCCCTGCCAGCTCCAGG - Intergenic
902009428 1:13259295-13259317 GGCTCCGCCCTGCAAGCTCCAGG - Exonic
902012912 1:13284043-13284065 GCCTCTGCCTTGCCAGCTCCAGG + Exonic
902017235 1:13318440-13318462 GGCTCCGCCCTGCAAGCTCCAGG - Exonic
902020975 1:13345266-13345288 GGCTCTGCCCTGCCAGCTCCAGG + Exonic
902024386 1:13371852-13371874 GGCTCTGCCCTGCCAGCTCCAGG + Intergenic
902026730 1:13389684-13389706 GGCTCTGGCCTGCCAGCTCCAGG - Exonic
902030146 1:13416381-13416403 GGCTCCGCCCCGCCAGCTCCAGG - Exonic
902054626 1:13590075-13590097 GCCTCAGCCCTCCCAAGTGCTGG + Intronic
902095293 1:13939001-13939023 GCCTCTGCCTTGTGATCTCCAGG + Intergenic
903044486 1:20554636-20554658 GCCTCTGCCCTGGCACCCCCAGG + Exonic
903438210 1:23368348-23368370 GCCTCCGCTCTGCCATCTCGAGG + Intronic
903458459 1:23504436-23504458 CCCTCTGCCCGGCCACCACCCGG + Intergenic
903779195 1:25810721-25810743 GCCCCTGCCCTTCCCACTCTGGG - Intronic
904476775 1:30770214-30770236 GTCCCTGCCCTGCCACCTCTGGG + Intergenic
904598864 1:31662920-31662942 GCCCCTGCCATGCCAGCCCCTGG - Intronic
904829425 1:33297103-33297125 TCCTCTGCCCTTTGAACTCCAGG - Intronic
905366682 1:37455398-37455420 GCCTCTGCCCAGCCGCCTGCAGG + Intergenic
906619092 1:47259536-47259558 GCCTCAGCCCTGCAAAGTGCTGG + Intronic
906886050 1:49650410-49650432 GCCTCTGCCCTTGCAACCCTAGG + Intronic
906954086 1:50358246-50358268 GCTGCTGCCCTCCCAACTCATGG - Intergenic
907329113 1:53659942-53659964 GCCCCTGCCCTGCTCCCTCCTGG + Intronic
907428752 1:54398119-54398141 GTCTCAGCTCTGCCAACACCTGG + Intronic
907441212 1:54479636-54479658 GACTCTGCCCTGCCAGCTATAGG - Intergenic
907565048 1:55426652-55426674 GCTTCTGCCCTATCAGCTCCTGG + Intergenic
907726491 1:57025161-57025183 GCCCCTCCCCTGCCCATTCCCGG - Intronic
908605624 1:65793651-65793673 GCCTCAGCCCAGCAAACTCTTGG - Intronic
908731014 1:67226429-67226451 GCCGCTGGACAGCCAACTCCAGG - Intronic
908738952 1:67307796-67307818 GCCTCTGCGCCACCAACTCCGGG - Exonic
912704979 1:111904921-111904943 CCCTCTGCCTTGGCCACTCCAGG + Intronic
914456382 1:147840988-147841010 GGCTCTGCCCCACCAGCTCCAGG - Intergenic
915437579 1:155920188-155920210 GCCTCTGCCTCCCCAAGTCCTGG - Intronic
915506344 1:156358865-156358887 GCCTCTACTGTGCCAATTCCAGG - Intronic
916407479 1:164511580-164511602 GCCTCAGCCCTGCCCCGTCCAGG + Intergenic
917140883 1:171834225-171834247 GCCACTGCCCGGCCAAATCTTGG + Intergenic
919419329 1:197351530-197351552 ATATCTGCCCTGCCAACTACGGG + Intronic
919773288 1:201176739-201176761 GCCTCTGGCCTCTCACCTCCTGG + Intergenic
920182221 1:204138930-204138952 GCCTCTTCCATCCCCACTCCCGG + Intronic
920219334 1:204385074-204385096 GCCTCTGCTCTGGCTTCTCCTGG + Intergenic
920784741 1:209030299-209030321 GCCTCTTCCCCTTCAACTCCAGG + Intergenic
921007101 1:211104697-211104719 GCATTTCCCCTGCCCACTCCAGG + Intronic
922272611 1:224048012-224048034 CCCTCTGTCCTCCTAACTCCCGG - Intergenic
922701651 1:227764654-227764676 GCCTCTGCCTCCCCAACTGCTGG - Intronic
922779378 1:228239857-228239879 GGCTCTGCCCTGCCTGGTCCAGG + Intronic
922910985 1:229217005-229217027 GCCTCTTCACTGTCACCTCCAGG - Intergenic
923262698 1:232282596-232282618 GCCTGTCCCCTGGCAAGTCCAGG - Intergenic
924075966 1:240337289-240337311 GCCTCTGCCTCCCCATCTCCTGG + Intronic
924582063 1:245331135-245331157 GGCTCTGCTCTGCCACCCCCAGG - Intronic
924788425 1:247220712-247220734 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1062787284 10:275788-275810 GTTTCTGCCCTGGCAGCTCCTGG - Exonic
1062878270 10:959072-959094 TGCCCTGCCCTGCCATCTCCAGG - Intergenic
1063746206 10:8885095-8885117 GCCTCTGCCCTGCAAAGTGCTGG - Intergenic
1065526078 10:26622523-26622545 GCCCCTGCCCCGCCGCCTCCCGG + Intergenic
1067020264 10:42790602-42790624 GCCTCTGCCTTGCAAAGTGCTGG - Intronic
1067851402 10:49756941-49756963 GTTTCTGCCCTGCCTAGTCCTGG - Exonic
1068111697 10:52687959-52687981 GCCTCGGCCTTCCAAACTCCTGG - Intergenic
1068666358 10:59679793-59679815 GCCTCTGCAGTACCAAATCCAGG + Intronic
1069049285 10:63775722-63775744 GCCTCTTACCTGCCCACTCTAGG + Intergenic
1069602145 10:69714922-69714944 GCCTGCGCCCTGCCAATTGCTGG + Intergenic
1069863313 10:71484591-71484613 GGCCCTGCTCTGCCATCTCCTGG + Intronic
1069929949 10:71875675-71875697 CCCTCTGCCCGGCCACCACCCGG - Intergenic
1069933972 10:71902448-71902470 GCCTCTGCCCTACCAGCTTTAGG - Intergenic
1070566468 10:77607033-77607055 GCCTCTGCCCTGACATCTTCAGG + Intronic
1070750656 10:78962255-78962277 GGGTCTGCCCAGCCATCTCCTGG + Intergenic
1070827788 10:79401274-79401296 GCCTGTGCCCTGCCAAACCCTGG + Intronic
1071860576 10:89668692-89668714 GACTCTGCCTTCCTAACTCCTGG + Intergenic
1072470299 10:95707086-95707108 GCTCCCGCCCTGCCAACTCAGGG + Intergenic
1072743087 10:97922093-97922115 GCCTCTTCCCAGCCTCCTCCCGG - Intronic
1074520843 10:114222360-114222382 GCTTCCTCCCTGCCCACTCCCGG + Intronic
1075522564 10:123151684-123151706 GCCTCAGCGCTGCGGACTCCAGG - Intergenic
1075663840 10:124216881-124216903 GCCAGTGCCCTCCCAGCTCCAGG - Intergenic
1075850247 10:125580878-125580900 GACTCTTCCCTTCCAGCTCCAGG - Intronic
1076178146 10:128384552-128384574 GCCTCTGCCATGTCCACTCAGGG + Intergenic
1076297486 10:129397771-129397793 GCCCTTGCCCTCCCCACTCCTGG + Intergenic
1076785928 10:132749938-132749960 GCCTTGTCCCTGCCACCTCCAGG + Intronic
1076786373 10:132751912-132751934 GCCTCTACCCAGACACCTCCTGG - Intronic
1076834960 10:133016392-133016414 GCCTGGACCCTGCCCACTCCAGG - Intergenic
1076919926 10:133446158-133446180 GGCTCTGCCCTGCCCCGTCCGGG + Intergenic
1077283398 11:1755464-1755486 GCCTCTGCACTGGCTGCTCCTGG + Intronic
1077325065 11:1960158-1960180 GCCCATGCCCTGGCAGCTCCAGG + Intronic
1077494659 11:2881017-2881039 CCCTCTGCCCTGCCAAGGTCAGG + Intergenic
1077675838 11:4192366-4192388 GCCTCTGGGCTGCTAACTTCAGG - Intergenic
1079312023 11:19375336-19375358 GCCTGTGCCCAGCCATCTTCTGG - Intronic
1080604561 11:33854346-33854368 GCCCCTTCCCTGCAAATTCCTGG + Intergenic
1080730113 11:34941872-34941894 GCCTCTGCTCTGGCCCCTCCTGG + Intronic
1080843790 11:36008348-36008370 GCCTCCTCCATCCCAACTCCAGG + Intronic
1080961669 11:37168091-37168113 GCCTTTGCCCTTTCAACTCCTGG - Intergenic
1083473727 11:62901912-62901934 GCCTCTGCCCAACCAAGTCTTGG - Intergenic
1083541388 11:63513953-63513975 TCCTCTGGCCTGCGAACTCCTGG - Intronic
1083620774 11:64048348-64048370 GCCTCTGTCCTGCTGACCCCGGG - Intronic
1083753880 11:64778598-64778620 GCCTCGGCCCGGCCCAATCCAGG - Intronic
1084069927 11:66727755-66727777 GCCTCTGCCCGGCGGACTGCGGG - Intronic
1084168643 11:67389616-67389638 GCCTCCACCCTGCCCCCTCCAGG - Intronic
1084225937 11:67714880-67714902 GCCTCTGCCCTGCCAGCAGCAGG + Intergenic
1084263768 11:67994754-67994776 GCCTCCGCCCTGCCAGCAGCAGG + Intronic
1084419121 11:69051563-69051585 GCCTCTGCCCCGCAACATCCAGG - Intronic
1084501240 11:69536669-69536691 CCCTCTGCCCGGGCATCTCCTGG + Intergenic
1084768758 11:71329128-71329150 GCCTCACCACTGCCACCTCCCGG + Intergenic
1084809643 11:71604366-71604388 GCCTCTGCCCTGCCAGCAGCAGG - Intergenic
1085253659 11:75159916-75159938 GCCTCTCACCTGCCCACTCATGG - Intronic
1087948823 11:104195092-104195114 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1088744636 11:112795353-112795375 GTCTCAGCCCTGCCACCTACCGG + Intergenic
1089133001 11:116226816-116226838 GCCTCAGCCTTGCCAGCTCAAGG + Intergenic
1089246391 11:117123645-117123667 GCCTCTGCCCCCCAAACTGCTGG - Intergenic
1089350117 11:117817266-117817288 AGCTCTGCCCTGCCAGCCCCTGG - Intronic
1089775499 11:120832683-120832705 GGCACTGCCCCTCCAACTCCAGG - Intronic
1089823091 11:121246365-121246387 GCCTCTGCCCTCCCAGGTGCAGG + Intergenic
1089923380 11:122231521-122231543 GCCTCTTCCCTGGGACCTCCTGG + Intergenic
1090437970 11:126702706-126702728 CTCTCTGCCCAGCCACCTCCTGG + Intronic
1090449906 11:126797121-126797143 GCCTCTGATTTGCTAACTCCAGG - Intronic
1091070367 11:132557409-132557431 GCTTCTCCCCTTCCAACTGCAGG - Intronic
1091319507 11:134639915-134639937 GCCTCTACCCTGCCTTCTCCAGG - Intergenic
1091319516 11:134639942-134639964 GCCTCTACCCTGCCTTCTCCAGG - Intergenic
1091319525 11:134639969-134639991 GCCTCTACCCTGCCTTCTCCAGG - Intergenic
1091319534 11:134639996-134640018 GCCTCTACCCTGCCTTCTCCAGG - Intergenic
1091319543 11:134640023-134640045 CCCTCTACCCTGCCTTCTCCAGG - Intergenic
1091319554 11:134640050-134640072 GCCTCTACCCTGCCTTCTCCAGG - Intergenic
1202808047 11_KI270721v1_random:15337-15359 GCCCATGCCCTGGCAGCTCCAGG + Intergenic
1091635493 12:2193725-2193747 GCCTCTGCCCTGACACCTCCAGG + Intronic
1091854695 12:3730046-3730068 GCCCCTGCCTTGCCATGTCCAGG - Intronic
1094491602 12:30964101-30964123 GCCTCAGCCCCTCCCACTCCAGG - Intronic
1095183830 12:39178360-39178382 GCCACTGGACAGCCAACTCCAGG + Intergenic
1095541018 12:43308624-43308646 GCCTCAGCCCTGCAAAGTGCTGG - Intergenic
1096677395 12:53232925-53232947 GCCTCTCCCCTTCCAAATCCAGG - Intronic
1097165696 12:57085329-57085351 GCCACCGCCCTGGCCACTCCTGG + Intronic
1099023793 12:77440308-77440330 GACTCTGGCCTTCCTACTCCTGG + Intergenic
1100480434 12:94972800-94972822 GTCTCTTCCCTTTCAACTCCAGG - Intronic
1101445913 12:104736692-104736714 CCCCCAACCCTGCCAACTCCGGG - Intronic
1101766220 12:107701925-107701947 GCCTCTGCCTTGCAAAGTGCTGG + Intronic
1102213647 12:111144951-111144973 GCCTCTGCCCTGCCTATCCCAGG - Intronic
1103047359 12:117748276-117748298 GCCTCCTTCCTGCCAGCTCCTGG - Intronic
1103207204 12:119139229-119139251 GCCTCTGCCCTTCCATCCCTGGG - Intronic
1103532436 12:121611689-121611711 GCCTCTGTCCCTCCAACCCCAGG + Intergenic
1103633033 12:122278420-122278442 CCCTCAGGCCTGCTAACTCCTGG + Intronic
1103675311 12:122651278-122651300 GCGTGTGCCCAGCCAACACCTGG + Intergenic
1103861803 12:124021228-124021250 GCCTCTGCCCTGCCCTGTGCTGG - Intronic
1103885757 12:124198966-124198988 GCCTCTGTCCTGCCAAGTTATGG + Intronic
1103893967 12:124261141-124261163 TCCTCTGCCTTTCCAGCTCCTGG + Intronic
1104046029 12:125163636-125163658 GCCTCGGCCCTGCAAAGTGCTGG - Intergenic
1104409147 12:128543679-128543701 AGCTCTGCCCTGCCACCTCCTGG + Intronic
1104423319 12:128654949-128654971 TCCCCTGCCCTGCCACCTCGGGG + Intronic
1104910850 12:132240319-132240341 GCCTCTGGCCGGCAGACTCCAGG + Intronic
1105410529 13:20167958-20167980 GCCTCTCCCCTCCAAACTCCTGG + Intergenic
1106994976 13:35470968-35470990 GCCTCTGCCCAGCCGAGTCGGGG - Intronic
1107321130 13:39189812-39189834 TCCTCTGTCCTGCTAACTTCGGG - Intergenic
1107737766 13:43416647-43416669 GCCTCTGCCCCGCCACCACCCGG - Intronic
1108448008 13:50528388-50528410 GCCAGTGCCATGACAACTCCTGG - Intronic
1108890011 13:55245282-55245304 GCCAGTGCCGTGCCAACTCTGGG + Intergenic
1110209533 13:72955020-72955042 GCATCTGCCCTCCCAACTCCAGG - Intronic
1110626388 13:77660212-77660234 GCCTCTGCCCGGCCCCCTCACGG - Intergenic
1110794696 13:79622839-79622861 GCCCCTGCACTGACCACTCCAGG - Intergenic
1112328439 13:98459410-98459432 GCCTCTGACCTGGCAAGTTCAGG - Intronic
1113657293 13:112075087-112075109 ACCTCTGCCCTGCAAATTCCAGG - Intergenic
1114280496 14:21188931-21188953 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1116639989 14:47448592-47448614 GCCTCTGTCCTGCTAACTTAGGG - Intronic
1117675274 14:58149444-58149466 CCCTCTTCCCTGCCAGCTCTGGG - Intronic
1117873289 14:60222926-60222948 AGCTCTGCCCTGGCAGCTCCTGG - Intergenic
1118423637 14:65634029-65634051 CCCTCTGCCCGGCCACCACCCGG + Intronic
1118428367 14:65692130-65692152 CCCTCTGCCCGGCCACCACCCGG - Intronic
1118584606 14:67341077-67341099 GCCTCTGCCCAGCCGCCACCCGG + Intronic
1119335046 14:73826481-73826503 ACCTCTGCCCTCCCCACCCCGGG + Intergenic
1119594798 14:75924812-75924834 TCCTCTGCCCGGCCACCACCCGG - Intronic
1121329605 14:93041616-93041638 GCCCCTGCCCAGCCCACACCCGG + Intronic
1121930407 14:97966838-97966860 GTCTCTTCCCTGCTAATTCCTGG - Intronic
1122420785 14:101575776-101575798 GCCACAGCCCTGCCATCCCCAGG - Intergenic
1124097731 15:26664785-26664807 ACCTCTGCACTGCCACCTCCTGG + Intronic
1125511228 15:40293530-40293552 GACTCTGCCCTGCCATGCCCTGG + Intronic
1126292776 15:47100123-47100145 GTCCCCGTCCTGCCAACTCCAGG + Intergenic
1127588163 15:60397699-60397721 ACCTCTGCCCTGCACCCTCCCGG + Intronic
1127848140 15:62889467-62889489 GCCGCTGCACTGCGACCTCCAGG - Intergenic
1129455516 15:75674474-75674496 GCCTCTGAACTTCCACCTCCTGG - Exonic
1130119449 15:81034561-81034583 TCCTCTGCTCTTCTAACTCCTGG - Intronic
1130522485 15:84673219-84673241 CCCTCTGCCCGGCCACCACCCGG + Intronic
1131127071 15:89867415-89867437 GCCTCTGCCCGGCCGCCACCCGG + Intronic
1131988102 15:98065419-98065441 GCCTCTGCCTTCCCAACAGCGGG + Intergenic
1132150402 15:99454582-99454604 CACTCTGCCCTGCCATCCCCGGG - Intergenic
1132399593 15:101497214-101497236 GCCTGTCCGCTGCTAACTCCAGG + Intronic
1132423330 15:101692984-101693006 GCCACTCCCCTCCCCACTCCAGG + Intronic
1132506296 16:310966-310988 CACACTGCCCTGCCAGCTCCTGG - Intronic
1132575337 16:661326-661348 GCCTCTTGCCTGCCAGGTCCTGG + Exonic
1132578874 16:676159-676181 ACCAGTGCCCTGCCAGCTCCTGG + Intronic
1132666587 16:1083682-1083704 CCCTCTGCCCTCCCAAGGCCGGG + Intergenic
1132882295 16:2167798-2167820 GCCCCAGCCCTGCCTACCCCAGG - Intronic
1133115889 16:3577759-3577781 GACTGTGCCCTGCCACCTCCAGG + Intergenic
1133172338 16:3988734-3988756 TCCTCTGCCGTGGCATCTCCAGG - Intronic
1133200153 16:4199253-4199275 GCCTCAGCCCTGACACCCCCTGG + Intronic
1133280352 16:4661612-4661634 GCCAGTGCCCTGCCAGCTCCTGG + Intronic
1133436733 16:5786304-5786326 ACCTCTGACCTCCCAAGTCCAGG + Intergenic
1133651964 16:7820982-7821004 GCCTCTCCCCGGCCATCTCTGGG + Intergenic
1134015975 16:10888750-10888772 GCCTCTGCCCTGCCCCCACATGG + Intronic
1134135301 16:11673267-11673289 GCCTCTCCCCTGCCACCATCCGG - Intronic
1134157650 16:11856629-11856651 GCCTCTGCCCTCCAAAGTGCTGG + Intergenic
1134171897 16:11976028-11976050 GCCTCCGCCCTCCCAAGTGCTGG + Intronic
1134256182 16:12613534-12613556 GCCTCTGCCCTTTGAACTCAAGG + Intergenic
1135103151 16:19624331-19624353 GCCTCAGCCCTGCAAAGTGCTGG - Intronic
1135415403 16:22264910-22264932 GCCTCTTCCCTGTCTCCTCCAGG + Intronic
1135668421 16:24354784-24354806 GCCTGTGCCCAGCCAGCCCCTGG - Intronic
1135909615 16:26547168-26547190 GCCCCTGCCCTGGATACTCCTGG - Intergenic
1136034369 16:27527750-27527772 GCCTCAGCCCTGCAAAGTGCTGG - Intronic
1136549443 16:30974891-30974913 GCCTCAGCCCTCCCAAGTGCTGG - Intronic
1136578851 16:31140253-31140275 GCCTCTCCCCTGCCTACTCCAGG + Intronic
1138343376 16:56305496-56305518 GCCTCTGCACTGGCTCCTCCTGG - Intronic
1138588702 16:57987648-57987670 GCCCGTCCCCGGCCAACTCCTGG + Intronic
1138617707 16:58184041-58184063 CCCTTTGCCTTGCCTACTCCAGG - Intronic
1139333472 16:66212630-66212652 GCAGCTGCCCTGTCAATTCCAGG - Intergenic
1139596640 16:67962042-67962064 TGCTCTGCCCAGCCACCTCCTGG + Intronic
1141524608 16:84603676-84603698 GCCTCTCCCCTCTGAACTCCCGG - Intronic
1141526289 16:84614113-84614135 GCCTCTAGCCTGGAAACTCCAGG - Intronic
1141659651 16:85435195-85435217 GCCTCGGCCCTGCACACGCCAGG + Intergenic
1141887092 16:86899515-86899537 GTCCCAGCCCTGCCATCTCCTGG - Intergenic
1142222076 16:88860491-88860513 TCCTCTTCCCTGCCAACCACAGG - Intronic
1142362946 16:89635886-89635908 GCCTCTCCCCGGCAAACTCCAGG + Exonic
1142428282 16:90012152-90012174 GCCTCAGACCTGCCAGGTCCAGG + Intronic
1145083651 17:19917013-19917035 GCCTCTGCCTTGCAAAGTGCTGG - Intronic
1146626123 17:34436871-34436893 GAGCCTGCCCTGCCACCTCCTGG + Intergenic
1146662055 17:34671265-34671287 GCCTCTTCCCAGTCAGCTCCAGG - Intergenic
1146894919 17:36534419-36534441 GCAGCTGCCCTGACACCTCCCGG + Intronic
1146910884 17:36647748-36647770 GCCTCAGCAGTGCCACCTCCAGG + Intergenic
1146920408 17:36706306-36706328 GCCCCCGCCCTGCCATCTGCCGG + Intergenic
1147627261 17:41908194-41908216 GACTCTGCCCTGAGAAGTCCTGG + Intronic
1147656981 17:42096659-42096681 TGCTCTGCCCTCCCACCTCCAGG - Intergenic
1148052518 17:44776064-44776086 GCCTCGGCCCTGCCCTCCCCAGG - Intronic
1148351947 17:46947392-46947414 GCCTCTGCCCTGCCTCCGCCTGG - Intronic
1148789522 17:50165677-50165699 GCCCCTACCCTTCCAACCCCAGG - Intronic
1148804940 17:50259269-50259291 GCCTGGGCCCTGCCCTCTCCTGG - Intergenic
1149429261 17:56584060-56584082 GCCTCCTCCCTGCCACCTCCAGG + Intergenic
1149624830 17:58073795-58073817 GCCTCTGCCCGGCCACCACCCGG - Intergenic
1149788366 17:59455515-59455537 GCCTCTGCCTTGCAAAGTGCTGG - Intergenic
1150214146 17:63457144-63457166 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1150357074 17:64495956-64495978 GCCTCTGCCTTGCAAAATGCTGG + Intronic
1151207371 17:72517903-72517925 GCTTCTGTCCTGCCATCTCTGGG - Intergenic
1151282952 17:73090079-73090101 GGCTCAGCCCTGCCAGTTCCCGG + Intronic
1151674903 17:75592337-75592359 CCCTCTGCCCTTCCTACTCTGGG - Intergenic
1152265463 17:79291759-79291781 CCCTCTCCCCTGGCAACTCTTGG + Intronic
1152575103 17:81136482-81136504 GCCTCAGCCTTCCCACCTCCAGG + Intronic
1152932173 17:83115607-83115629 GCCTCTGCCCTTTCCTCTCCAGG + Intergenic
1155096393 18:22559869-22559891 GCCTCTGCCCTGCCCGAGCCGGG - Intergenic
1155461590 18:26090403-26090425 GCCTCGGCCCGGTCGACTCCGGG + Intronic
1155479544 18:26270564-26270586 GCCTCTGCCTTGCAAAATGCTGG + Intronic
1157621930 18:49021663-49021685 GGCTCAGCCCTGCCCACTTCTGG + Intergenic
1157693862 18:49705182-49705204 GCCTCAGCCCTGCAAAGTGCTGG + Intergenic
1158358288 18:56644265-56644287 GCCTCAGCCCTGCAAAGTGCTGG + Intronic
1158414956 18:57242117-57242139 ACCACTGCCCTGCCCACCCCAGG - Intergenic
1158581353 18:58686438-58686460 GCCTCTGCTCTGCCCATTCCAGG - Intronic
1159048250 18:63391476-63391498 GCCTCTGCCTTGCGAAGTGCTGG + Intronic
1159549036 18:69875897-69875919 TCTTCTGCCCTCCCACCTCCTGG - Intronic
1159961614 18:74559532-74559554 GCCTCTCCCTTGCCACCCCCGGG - Intronic
1160408515 18:78659337-78659359 GCCCCTGCCCTCCCCGCTCCAGG - Intergenic
1160967299 19:1752384-1752406 GCCTCTGCCCCCCCCACCCCCGG - Exonic
1160967602 19:1753492-1753514 GCCGCTCCCCTGCCACATCCTGG + Exonic
1161349469 19:3784103-3784125 GCCCCTGTCCTGCCCACTCACGG + Exonic
1161713472 19:5863033-5863055 CCCGCAGCCCTCCCAACTCCTGG - Intergenic
1161885717 19:6993772-6993794 GCCTCTGCCCTCCAAAGTGCTGG - Intergenic
1161945052 19:7430450-7430472 GCCTCAGCCCTGCAAAGTGCTGG + Intronic
1162140056 19:8580358-8580380 ACCTCTGCCCTGCCCGCCCCAGG - Exonic
1162887132 19:13703992-13704014 CCCTCTGCCCGGCCACCGCCCGG + Intergenic
1163314633 19:16533351-16533373 GTCAGTGCCCTGCCCACTCCAGG - Intronic
1163463703 19:17454637-17454659 CCCTCTGCCCTGACCCCTCCTGG + Intronic
1163587009 19:18169601-18169623 CCCTCTGCCCTGCCCACCGCAGG + Exonic
1164680819 19:30132555-30132577 GCCTCTGCACTTCCCAGTCCAGG - Intergenic
1165013517 19:32864908-32864930 GCGGCTGCCCTGGCAACACCGGG + Intronic
1165094065 19:33401076-33401098 CCCTCAGCCCTCCCAACCCCAGG - Intronic
1165389513 19:35530216-35530238 TTCTCTGCCCAGCCACCTCCTGG - Intergenic
1165655230 19:37526833-37526855 GCCACTGGCCTACCACCTCCAGG - Intronic
1166844562 19:45718692-45718714 CCCTCTTCCCTGCCTACTCTGGG + Intronic
1166924815 19:46260311-46260333 GTCTCTGCCCTCCCACCTCTAGG - Intergenic
1167193486 19:48008884-48008906 GCCTCAGCCCTGCAAAGTGCTGG - Intronic
1167326366 19:48828678-48828700 GCCTCAGCCTTTCAAACTCCTGG - Intronic
1167838689 19:52095962-52095984 GCCTCGGCCCCGCCCACCCCTGG - Intergenic
1168469175 19:56627113-56627135 GCCTGTGCCGTGCCAAGTGCTGG - Intergenic
926307979 2:11653329-11653351 TCTTGTGCCCTGCCAACACCTGG + Intergenic
926347705 2:11963488-11963510 GCCTCTGCCCTGAGATCTGCTGG - Intergenic
926575098 2:14571478-14571500 GCCTCAGCCCTGCAAAGTGCTGG - Intergenic
926683438 2:15680628-15680650 GCCTCTGCCCGGCCGCCACCCGG - Intergenic
927792354 2:26020261-26020283 GACTCTGCCCTGCCAGCACGAGG + Intergenic
927939035 2:27092340-27092362 GCCTCCGCGCTGCCATCTCTGGG - Exonic
928334240 2:30382523-30382545 GCCTCCCACCTGTCAACTCCTGG - Intergenic
928922798 2:36542689-36542711 GCCCCTCCCCTGCCTAGTCCAGG - Intronic
930612269 2:53555640-53555662 CCCTCTGCCCTGCAGACACCCGG - Intronic
931114451 2:59149286-59149308 TCCTCCTCCCTGCCAACCCCTGG + Intergenic
931721784 2:65072180-65072202 GCCACTGCCCTGCCATTTTCTGG + Exonic
932142394 2:69291537-69291559 GCTTCTTCCCTGCCAATTTCAGG + Intergenic
933576721 2:84077771-84077793 TCCTCTGCCCTGACAGCTCCAGG + Intergenic
933761528 2:85675565-85675587 GCCTCTCCCATGCCGCCTCCTGG + Intergenic
934087751 2:88524681-88524703 GCTCCTGCCCTCCCACCTCCAGG - Exonic
934650504 2:96088898-96088920 GCCACCGTCCTGCCAGCTCCAGG - Intergenic
934703352 2:96461195-96461217 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
935575140 2:104701459-104701481 GCCCCTGCCCTCCCAACGGCGGG - Intergenic
935850016 2:107208174-107208196 CCATCTGCAATGCCAACTCCTGG - Intergenic
937285755 2:120750158-120750180 GCCTCAGCCCCTCCCACTCCAGG + Intronic
937300989 2:120841682-120841704 TCCTCTGTCCTGCCAGCACCTGG - Intronic
937339479 2:121081982-121082004 GCCTCTGCCCTGCAAACTTCAGG + Intergenic
937341165 2:121091490-121091512 GCCTCTGGCCTCCCAAGTACTGG - Intergenic
937413118 2:121693583-121693605 GCCTCAGCCCTGCAAAGTGCTGG - Intergenic
937866046 2:126752644-126752666 CCCTCTCCCCTCCCAACTCCAGG + Intergenic
937974856 2:127576503-127576525 GCCTCTGCCCAGCCCAGCCCTGG - Intronic
938044832 2:128109139-128109161 GCCTCTGCCCCGCAAATTGCTGG + Intronic
938055068 2:128208559-128208581 GCCTCTGTCCTGCCGCCGCCCGG + Intergenic
938055195 2:128209149-128209171 GCCTCTGCCCTGCCGCTGCCTGG + Intergenic
938342333 2:130544029-130544051 GCCTGAGCCCTTCCAACTTCAGG - Exonic
938347499 2:130576680-130576702 GCCTGAGCCCTTCCAACTTCAGG + Exonic
939878829 2:147607023-147607045 GCCTCTGCCCTGCATAGTCAGGG - Intergenic
941047830 2:160696338-160696360 TCCTCTGCCCTTCCCACCCCAGG + Intergenic
941967463 2:171313695-171313717 GCCTCTGCCTTGCAAAATGCTGG + Intergenic
942181087 2:173381393-173381415 GCCTCGGCCTTGCAAACTGCTGG + Intergenic
942331358 2:174828048-174828070 CCCTCTTCCCTCCCAACTCAGGG - Intronic
943005876 2:182386885-182386907 CCCTCTGCCCGGCCACCACCCGG + Intronic
943125860 2:183792670-183792692 GCCTCTGCCCAGCCACCACCCGG - Intergenic
945949247 2:216023221-216023243 TCCTCTGTGCTGCCACCTCCTGG + Intronic
946309013 2:218872560-218872582 GAGTCTGCCCTGCCCCCTCCTGG - Intronic
946448937 2:219763444-219763466 GCCTCGGCCCTGCAAACTGCTGG + Intergenic
947708301 2:232293969-232293991 GCCTGGTCCCTGCCACCTCCGGG - Intronic
948068814 2:235103237-235103259 ACCACTGACCTGCCAACCCCAGG + Intergenic
948132000 2:235607750-235607772 CCCGCTGCCCTTCCACCTCCAGG - Intronic
948186782 2:236027507-236027529 GCCTCTGCCCTGCCTCCCCCAGG + Intronic
948680382 2:239630043-239630065 GCCTGTGTCTTGCCAACTCAAGG - Intergenic
1168799220 20:633749-633771 CCCTCTGGCCTGCCCACGCCTGG - Intergenic
1169140880 20:3226977-3226999 GCCCCTGCCCTGTAAAATCCAGG + Intergenic
1169194686 20:3676847-3676869 ACCTCCGCCCTCCCAACCCCAGG - Intronic
1169274411 20:4224001-4224023 CCCTCTGCCCTGCCTCATCCTGG - Intronic
1170628767 20:18050277-18050299 GCCTCTGCCCAGTTAACTCGGGG - Intronic
1170965870 20:21070870-21070892 GCCTCAGCCCTGCAAAATGCTGG + Intergenic
1171178070 20:23069748-23069770 TCTTCTTCCCTCCCAACTCCTGG - Intergenic
1172146559 20:32762171-32762193 CCCCCTGCCCTCCCAACCCCGGG - Intergenic
1172242448 20:33422489-33422511 GCTACTGCCCAGCCAACTCTGGG - Intronic
1172252472 20:33489806-33489828 GCCACTGCCCTGGCTACACCGGG + Intergenic
1172931283 20:38588110-38588132 GCCACTGCCCTGCTGACTCCAGG - Exonic
1173020707 20:39265563-39265585 ACCTCTTCCCTGACACCTCCTGG - Intergenic
1173223553 20:41148113-41148135 GCCTCTGACCTGACGACTTCCGG + Intronic
1173501784 20:43559146-43559168 GCCTCTCACCTGAAAACTCCAGG - Intronic
1173669392 20:44787497-44787519 GTCCCAGCCCTGCCACCTCCAGG - Intronic
1174363907 20:50044717-50044739 GCCTCTCCACTGCCATTTCCTGG + Intergenic
1175540384 20:59744247-59744269 GCCTCAGCCCCGCCACCTGCTGG - Intronic
1175556307 20:59860200-59860222 CCCCCTGCCCTGCCAAGACCAGG - Intergenic
1175893429 20:62325331-62325353 GCCTGTGCCCCGCCAGCTACCGG - Exonic
1175896390 20:62337660-62337682 GCAGCTGCACTGCCCACTCCGGG + Exonic
1175903704 20:62369873-62369895 GCCCCTGCCCACCCAGCTCCAGG + Intergenic
1176022830 20:62970880-62970902 GCCTCTGCCAGGTCAGCTCCAGG + Intergenic
1176159272 20:63640387-63640409 CCCGCTGCCCTTCCAACACCTGG + Exonic
1177833755 21:26169401-26169423 GCCTCTTCCCTGGCAGCTCTGGG - Intronic
1178041185 21:28642557-28642579 GCCCCTGCCCTCTCAACACCAGG + Intergenic
1178075855 21:29012238-29012260 CCCTCTGCCCGGCCACCACCCGG + Intronic
1178498294 21:33105208-33105230 GCCTCTGCCCTAGCCTCTCCTGG + Intergenic
1178547518 21:33505120-33505142 ACCTCCTCCTTGCCAACTCCTGG + Intronic
1179344718 21:40546049-40546071 GCCTATGCACTGCCAGGTCCTGG - Intronic
1179635394 21:42705445-42705467 GCATCTCCCCTGCCAGCTCCTGG - Intronic
1179930896 21:44570164-44570186 GCCTCTGCCCTGCTGAGCCCCGG + Intronic
1179998441 21:44984578-44984600 GCCCCGGCCATGCCAGCTCCAGG - Intergenic
1180858199 22:19061412-19061434 GCCCCTCCCCTGCAGACTCCAGG + Intronic
1181409536 22:22709258-22709280 GCTTCTGCCCTGCTCACCCCTGG - Intergenic
1181417003 22:22767432-22767454 GCTTCTGCCCTGCTCACCCCTGG - Intronic
1181609944 22:24005559-24005581 GCCTCTCCCCAGCCTACTCCTGG - Intergenic
1181670003 22:24421546-24421568 GTGTCTGCCCTGCCCCCTCCTGG - Intronic
1181778776 22:25178335-25178357 CCCACTGCCCTTCCAACACCTGG + Intronic
1181937121 22:26446973-26446995 GCCTCTGCCCCGCAAAGTGCTGG + Intronic
1182510092 22:30813421-30813443 GCCTCTGCCCCGCAAAGTGCTGG + Intronic
1182667889 22:31972476-31972498 CCCACTGCCCTGGCACCTCCTGG - Intergenic
1182787222 22:32917910-32917932 GCCTCTGCCCTTGCCACTGCCGG - Intronic
1183194758 22:36345766-36345788 GCCTCAGCCTGGCCAACACCTGG + Intronic
1183492650 22:38124831-38124853 GTCTCTCCCCTGCCACCTCTAGG - Intronic
1183598609 22:38827011-38827033 GCCTCTGGCCTGTCTACCCCGGG - Intronic
1183923189 22:41185681-41185703 GCCTCTGCCCTACAAAGTGCTGG - Intergenic
1183942235 22:41302248-41302270 GCCGCGGCCCCTCCAACTCCGGG - Intronic
1184017847 22:41799659-41799681 TTCTCTGCCCTGCCAGCCCCAGG - Intergenic
1184420517 22:44380263-44380285 GCCTCTCCCCTGCTCACCCCTGG - Intergenic
1184425795 22:44408585-44408607 GCCTCTGCCCTGCGGAATCCTGG - Intergenic
1184487930 22:44792394-44792416 GCCTCTCCCCTTCCTCCTCCTGG + Intronic
1184650735 22:45918462-45918484 GCCTCTGCCCTGCTGCCACCGGG - Intergenic
1184740078 22:46422970-46422992 GCCTCTGCAATGCCACCTCCTGG + Intronic
1184801527 22:46763184-46763206 GCCTCAGCCCGGCCAGCTTCCGG - Intronic
949869685 3:8577740-8577762 GCCTCAGCCTTTCAAACTCCTGG - Intergenic
950125289 3:10506626-10506648 TCCACTGCCCTGCCCCCTCCAGG + Intronic
950522530 3:13505466-13505488 GCCTCAGCCCTGTCGCCTCCAGG + Exonic
951779476 3:26346770-26346792 GCCTCTGACCTACCACCTCCTGG - Intergenic
952409553 3:33034824-33034846 GCCTCCCACCTGCCAGCTCCAGG + Intronic
953179646 3:40583778-40583800 CCCTCTGGCCTGCCTAGTCCTGG - Intergenic
953389522 3:42526284-42526306 CTGCCTGCCCTGCCAACTCCCGG - Intronic
953573070 3:44087857-44087879 GTCTCTGCCCTCCCAGTTCCTGG - Intergenic
953969295 3:47334588-47334610 GGCTCTCCACTGCCAACTGCAGG - Intronic
954099115 3:48355794-48355816 GCCTCTACCCTGTCATGTCCTGG - Intergenic
954371731 3:50172509-50172531 GCCTTGGCCCCTCCAACTCCAGG - Intronic
954708791 3:52494942-52494964 GCCTCCACCTTTCCAACTCCAGG - Intergenic
955557979 3:60158559-60158581 GCCTCTGCCTTGCAAAGTGCTGG + Intronic
957079200 3:75622706-75622728 GCCTATGCCCTGCCAGCAGCAGG + Intergenic
959146676 3:102555141-102555163 GCCTCTGCCCTGCAAAGTGCTGG - Intergenic
959849900 3:111072723-111072745 GGCTCTGCCCTGACAGCTTCTGG + Intronic
960721482 3:120628401-120628423 GCCACTTCACTCCCAACTCCAGG - Exonic
960898442 3:122530282-122530304 GCCTCTGTCCTTCCAAATCCAGG - Intronic
961451528 3:127004411-127004433 GCCTCTGCCCTGGAAACCCAGGG - Intronic
961669403 3:128517974-128517996 CTCTCTGCCCTGCAAACCCCCGG - Intergenic
962245300 3:133785678-133785700 GCCTCTGCCCAGCCACCACCCGG + Intronic
962740737 3:138361230-138361252 GCCTCTGCTCTGCTGATTCCTGG - Intronic
962804150 3:138915357-138915379 GCCGCTGCACTCCCAGCTCCTGG - Intergenic
963771763 3:149393517-149393539 GCCTCCGCATTGCCAACTCCAGG + Intergenic
964120061 3:153174070-153174092 GCCTCTTTCCAGCCCACTCCAGG + Intergenic
964449466 3:156797539-156797561 GACTGTGCCCTGCTAGCTCCAGG + Intergenic
965419145 3:168435650-168435672 GCTCTTGCCCTGCCAACTCTTGG + Intergenic
965590460 3:170357065-170357087 GCCTCCGCCCTGCCGGCTGCTGG + Intergenic
967197715 3:187043117-187043139 GGCCCTGCGCTGCCACCTCCGGG + Exonic
967975688 3:195033582-195033604 GCCTGTGGCCTGCGACCTCCTGG - Intergenic
968681628 4:1924968-1924990 CACTCTGCCCTGCCCACCCCTGG + Intronic
968934130 4:3601160-3601182 GCCTCTGCCCTTGCCCCTCCAGG - Intergenic
969720579 4:8891273-8891295 GCCCCTGCACTGCCAGTTCCAGG + Intergenic
973274296 4:48292174-48292196 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
974441259 4:61921278-61921300 ACCTCTGCATTGCTAACTCCAGG + Intronic
974597786 4:64037047-64037069 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
976714987 4:88114051-88114073 GCCTCTGCCCTGCAAAATACTGG - Intronic
977780627 4:100976981-100977003 GCCTCAGCCTTCCCAACTGCTGG - Intergenic
978351645 4:107825490-107825512 ACCTGTGCCCTTCCAACGCCAGG - Intronic
979343795 4:119560992-119561014 GCCTCTGTCATCCCAACTACTGG + Intronic
981692731 4:147527818-147527840 GGCTCAGGGCTGCCAACTCCCGG - Intronic
981970858 4:150660534-150660556 GCCTCTGCCCAGCCACCACCCGG + Intronic
982117142 4:152107151-152107173 GCCTCTGCCCTGCACACACATGG + Intergenic
982373190 4:154656998-154657020 GCCTCTGCCCCGCAAAGTGCTGG - Intronic
982464024 4:155707912-155707934 ACCTCTGCCCCGCCAGGTCCCGG + Intronic
982957625 4:161792113-161792135 GCCTGGGCTCTCCCAACTCCTGG + Intronic
984738937 4:183140059-183140081 GCCTCTGCCTTACAAAGTCCTGG + Intronic
986713189 5:10502609-10502631 TCCTCTGACCTGCCCACTTCAGG - Intergenic
986762820 5:10895569-10895591 GACTCTGGGCTGCCAACCCCTGG - Intergenic
987146848 5:14999903-14999925 GCTTCTCCCCTGACAACTCCTGG + Intergenic
988346763 5:30047071-30047093 GCCTCTGTCCTACCACGTCCAGG - Intergenic
988641124 5:33041706-33041728 GCCTCTGCCTTGCAGACACCTGG + Intergenic
991942171 5:71863566-71863588 AACTCAGCCCTGCCAACACCAGG - Intergenic
992482587 5:77166733-77166755 GCCTGGGCCCTGACAAGTCCTGG - Intergenic
992645136 5:78804759-78804781 GCCTCTGACCTCCCAGCTCCCGG + Intronic
993730147 5:91412705-91412727 TCCTCTGCCCTCCCAGCCCCAGG - Intergenic
995291009 5:110453548-110453570 GCCTCTGCCATGCAAAGTGCTGG + Intronic
996324687 5:122259118-122259140 CCCTCTGCGCTTGCAACTCCAGG - Intergenic
997228118 5:132224757-132224779 GCCTCTGACCTGCTCATTCCAGG + Intronic
997236597 5:132275594-132275616 GCCTCGGCCCTGCCATCCCCAGG + Intronic
997499416 5:134360452-134360474 GCCTCAGCCTCCCCAACTCCTGG + Intronic
1001116854 5:168947446-168947468 ATCTCTGCACTGCCACCTCCTGG - Intronic
1001962995 5:175891802-175891824 GCATCTGCCCTGCCTACTGCTGG + Intergenic
1002536495 5:179878938-179878960 GCTCCTGCCTGGCCAACTCCAGG + Intronic
1002668307 5:180844394-180844416 GGCTTTGCCCTGCCCACCCCAGG + Intergenic
1002923068 6:1586904-1586926 GCCTCGGCCCTGCAAAGTGCTGG + Intergenic
1003033687 6:2624319-2624341 GCCTCTGTGCTGGCTACTCCTGG + Intronic
1003039844 6:2677696-2677718 GCCTCTGTTCTGCCAATTACTGG + Intronic
1003072085 6:2952873-2952895 GCATCCGCCCTGCCACCTACAGG - Intronic
1004751961 6:18571297-18571319 ACCTCTGCCCTCCCTTCTCCCGG + Intergenic
1005778050 6:29159775-29159797 GCCTCTGCCCTGCAGGCTCCAGG + Intergenic
1005778811 6:29166104-29166126 GCCTCTGCCCTGCAGGCTCCAGG - Intergenic
1006378324 6:33683998-33684020 GACTCTGCCCTGCCCACCCCAGG + Exonic
1006631835 6:35435733-35435755 GCCTCTTCCCTGCAACCTCCTGG - Intergenic
1006725519 6:36196830-36196852 GCCTCCGCCGTGCCCCCTCCCGG - Exonic
1008904171 6:56658013-56658035 GCCTCGGCCCCCCCAACTGCTGG + Intronic
1008919302 6:56824964-56824986 CCCTCTGCCCGGCCACCACCTGG + Intronic
1011283706 6:85702518-85702540 GCCTCAGCCCTGCAAAGTGCTGG + Intergenic
1013367577 6:109447303-109447325 GCCCCTGCCCTGCCCTCCCCGGG + Intronic
1017969237 6:159297039-159297061 GCATGTGCCCTGCTAAATCCTGG - Intergenic
1018310580 6:162504125-162504147 CCCTCTGCCTTTCCAACCCCTGG - Intronic
1018629441 6:165809560-165809582 GCCTCTAGCCTGCCAACTCCTGG + Intronic
1018671075 6:166177862-166177884 ACTCCTGTCCTGCCAACTCCTGG - Intergenic
1018939261 6:168297541-168297563 GAGTCAGCCCTGCCAACACCTGG + Intronic
1019053983 6:169207103-169207125 GCCTCGGCCTTGCAAACTCTTGG - Intergenic
1019277823 7:185115-185137 CCCTCTGCTCTGCCTTCTCCGGG + Intergenic
1019453818 7:1114298-1114320 GCCTCTGCCCTGACAGATCGTGG - Intronic
1019519850 7:1455639-1455661 GCCTCTGCCCCACCGACCCCGGG - Intronic
1019659715 7:2217375-2217397 GCCTCTGCCATGTCCGCTCCTGG - Intronic
1019910269 7:4096251-4096273 GGCTCTGCCCTGCCACAGCCAGG - Intronic
1019942941 7:4305574-4305596 CCCACTGACCAGCCAACTCCTGG - Intergenic
1020309710 7:6858703-6858725 GCCTCTGCCCTGCCAGCAGCAGG + Intergenic
1021199298 7:17710443-17710465 GACTCTGTCCTTCCACCTCCAGG - Intergenic
1022336245 7:29424570-29424592 GCCTGTGCACTGCCAATTCATGG - Intronic
1023736540 7:43240774-43240796 GCTTATGCCCTGCAAACCCCTGG - Intronic
1024051755 7:45628164-45628186 GCCTCTGGCCTGCAAAATCCAGG - Intronic
1025004154 7:55342472-55342494 ACCTCAGCTCTGCCAGCTCCCGG + Intergenic
1025264787 7:57447549-57447571 GCCTCTGCCTTCCAAACTGCTGG - Intergenic
1026282337 7:68933091-68933113 CCCTCTACCCTGCTCACTCCAGG + Intergenic
1026285799 7:68961881-68961903 ACCTCTGCCCTGCAAAGTGCTGG - Intergenic
1026569100 7:71513940-71513962 GCCTCGGCCCTGCAAAGTGCTGG - Intronic
1027421379 7:78020248-78020270 GCCTTGGCCCTGCTAACTTCCGG + Intronic
1028130687 7:87169207-87169229 GCCTCTGCCCCGCAAAGTGCTGG - Intronic
1029446519 7:100615897-100615919 GCCTCGGCCCTGCAAAGTGCTGG - Intergenic
1029530363 7:101121469-101121491 CCCTCTCCCCTGCCAGCCCCTGG - Intergenic
1029611959 7:101631168-101631190 GGCTCTGCCCTCCAAACCCCAGG - Intergenic
1031995893 7:128230705-128230727 GCATCTGCCTTGACAGCTCCCGG + Intergenic
1032442886 7:131955634-131955656 TCCTCTGCCCTGGCACCTCCAGG - Intergenic
1032538945 7:132687510-132687532 GCCACTGCACTGTCAGCTCCAGG + Intronic
1032927507 7:136624516-136624538 GCCTCTGCCTCGCAAACTACTGG - Intergenic
1033284506 7:140028620-140028642 TCCTCTGCCCTGCCAGACCCAGG - Exonic
1033436994 7:141342195-141342217 GCCTCTGCCTTCCAAAGTCCTGG + Intronic
1034466422 7:151232625-151232647 GCCTCCGCCCCGCCCCCTCCCGG + Exonic
1034998569 7:155593861-155593883 GCCACTGCTCTGCCAGCTCTGGG + Intergenic
1035240156 7:157524029-157524051 GCCTCCACCCTGGCATCTCCAGG + Intergenic
1035485091 7:159217022-159217044 GCCTCTGCCCAGCCACCCACTGG - Intergenic
1037387785 8:18361896-18361918 GCATCTGCAGTGCCACCTCCTGG - Intergenic
1037555366 8:20017237-20017259 GCCTCAGCCCTGCAAAGTGCTGG + Intergenic
1037608513 8:20457380-20457402 CCTGCTGCCCAGCCAACTCCTGG + Intergenic
1037950349 8:23015399-23015421 ACCTCTGTTCTGCCCACTCCTGG - Intronic
1038169795 8:25119924-25119946 GCCTCTGCCCCTCCAAGTGCTGG + Intergenic
1039201103 8:35094667-35094689 GCCTCTGCCCAGCCGCCGCCCGG - Intergenic
1039560148 8:38505994-38506016 ACCTCTGCCCTGCCAGCTGCTGG + Intergenic
1039579364 8:38651220-38651242 GCCTCAGCCCGGCCTCCTCCTGG + Intergenic
1040593696 8:48818631-48818653 CCATCTGCCCTGCCACCTGCTGG - Intergenic
1040834678 8:51719121-51719143 CCCTCTGCCCTGCCGCCACCCGG + Intronic
1040895657 8:52365948-52365970 GCCTCGGCCCTACCAAAGCCAGG + Intronic
1041080895 8:54214082-54214104 GCCTCTGCCCTCCTGACTGCTGG + Intergenic
1043798742 8:84579288-84579310 GCCTGTCCTCTGCCCACTCCTGG - Intronic
1045017156 8:98009904-98009926 GCCTCTGACCTCCAACCTCCAGG - Intronic
1047868476 8:129056070-129056092 GCCTTTACTCTCCCAACTCCAGG + Intergenic
1048194983 8:132325091-132325113 GCGTCAGCTCTGCCCACTCCAGG - Intronic
1048755452 8:137733162-137733184 GTCTCTGCCTGGCCAACTCTCGG + Intergenic
1048889318 8:138933742-138933764 TCCTCTGCCCTGTGGACTCCAGG - Intergenic
1049140411 8:140949507-140949529 GCCTCTCCCCAGCCCACTCCAGG + Intronic
1049164453 8:141117636-141117658 GCCTCTGCCCTGCCTCCACCTGG + Intronic
1049321323 8:141998401-141998423 GCCTCGGCCCTGGCACCTACAGG + Intergenic
1049371307 8:142268862-142268884 GGCCCTGCCTTGCCAGCTCCAGG + Intronic
1049598770 8:143497604-143497626 GTCTGTGCTCTGCCTACTCCAGG - Intronic
1049808922 8:144554464-144554486 GCCTCAGCTCTGCCATCCCCAGG - Intronic
1051170877 9:14316482-14316504 GCCCCTGCCCCGGCAAATCCTGG + Intronic
1051640432 9:19219944-19219966 GCCTCGGCCCTGCAAAGTGCTGG - Intergenic
1052259091 9:26492707-26492729 GCCTCTGCCCGGCCGCCACCCGG + Intergenic
1053466410 9:38311732-38311754 CCCTCTGCCCAGCCCACTCTAGG - Intergenic
1053634529 9:39983334-39983356 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1054209358 9:62267363-62267385 CCCTCTGCCCGGCCACCACCCGG - Intergenic
1054456023 9:65430819-65430841 GCCTCTGCCCTTGCCCCTCCAGG + Intergenic
1056121515 9:83493170-83493192 CCCTCCTCCCTTCCAACTCCTGG - Intronic
1056576122 9:87857343-87857365 GCCTCTGCCCTGCCCCCGCAAGG - Intergenic
1056705167 9:88946169-88946191 GCCCCTGCCCTGCCAATACTTGG + Intergenic
1057128871 9:92639785-92639807 GCCTCTACCTTCCCAAATCCAGG - Intronic
1057266092 9:93619208-93619230 ACCCCTGCCCAGCCATCTCCTGG + Intronic
1057276508 9:93678486-93678508 GCCCCTGCCCTGCCAGTCCCAGG - Exonic
1057829430 9:98395548-98395570 GTCTCTGCTCTGCCCACCCCAGG - Intronic
1059396622 9:114038219-114038241 GCCTGCGCCCTGCCAGCTTCTGG + Intronic
1060353140 9:122877313-122877335 GCCTCAGCCCCGCAAACTGCTGG + Intronic
1060491005 9:124084195-124084217 ACCTCAGCCCTGCTAAATCCTGG + Intergenic
1060498063 9:124132526-124132548 GCCTCGGCCCTGCAAAGTGCTGG + Intergenic
1060520783 9:124292772-124292794 GCCTCTCCTCTGCCAACTGCTGG + Intronic
1061084139 9:128389587-128389609 GCCCCTGTTCTCCCAACTCCTGG + Exonic
1061390687 9:130315594-130315616 GACTCTGCCCTGCCATCCTCGGG + Intronic
1061534346 9:131238496-131238518 GCCTCTGCCCAGCCCCCGCCGGG - Intergenic
1061806028 9:133138168-133138190 GCACCAGCCCTGCCACCTCCTGG - Intronic
1061866682 9:133494912-133494934 GCCTTTTCCCTTCCAGCTCCTGG + Intergenic
1062403540 9:136382900-136382922 GCCTCTGCCCTCCCCAACCCTGG + Intronic
1062452133 9:136620252-136620274 TCCTCTCCCCTGCACACTCCAGG - Intergenic
1062498686 9:136843227-136843249 GCCTCTGCACACCCAACACCTGG - Intronic
1062516467 9:136939446-136939468 GCCTCTGCCCTGCCAACTCCTGG - Intronic
1062574802 9:137201040-137201062 GCCTCTGCGCTCTCAGCTCCCGG + Intronic
1062666532 9:137676316-137676338 GCCTCGGCCCTGCAAAGTGCTGG + Intronic
1189210538 X:39278476-39278498 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1189535762 X:41934090-41934112 CACTCTGCCCTGCCAACAACAGG - Intergenic
1189725406 X:43963949-43963971 GCCTCCAGCCTGCCAACTCCAGG + Intronic
1189968171 X:46395186-46395208 CCCTCTGCCCGGCCACCACCCGG - Intergenic
1190176914 X:48158024-48158046 GCCACTGCTCTGCCCCCTCCAGG - Intergenic
1190750773 X:53359647-53359669 TCATCTACCCTGCCAAATCCTGG + Intergenic
1190801867 X:53796596-53796618 TCATCTACCCTGCCAAATCCTGG + Intergenic
1191213979 X:57916771-57916793 ACCTCTGCCCTCCTGACTCCAGG + Intergenic
1192099412 X:68248131-68248153 ACCACCACCCTGCCAACTCCTGG + Intronic
1194016353 X:88625753-88625775 GTCACTCCACTGCCAACTCCAGG + Intergenic
1194369803 X:93058752-93058774 CCCTATGCCCTTCCAACCCCGGG + Intergenic
1197199363 X:123734448-123734470 CCCTCTGCCCGGCCACCACCCGG + Intergenic
1197361193 X:125505243-125505265 GCCACTGTCCTCCCAACTCCAGG - Intergenic
1198084092 X:133266461-133266483 GCCTCTGCCCTGCTGCCTTCTGG - Intergenic
1198275480 X:135094857-135094879 GGCTTTTCCCTGCCAGCTCCTGG + Intergenic
1198311036 X:135425840-135425862 GGCTTCTCCCTGCCAACTCCTGG - Intergenic
1199699254 X:150364066-150364088 CTCCCTCCCCTGCCAACTCCTGG + Intronic
1199973323 X:152876524-152876546 GCCTCAGAGCTTCCAACTCCTGG - Intergenic
1200211636 X:154349224-154349246 GCCACCTCCCTGCCACCTCCTGG - Intronic
1200677992 Y:6174962-6174984 CCCTATGCCCTTCCAACCCCGGG + Intergenic
1200795626 Y:7338762-7338784 GCCTCTGCCCCCCCAAGTGCTGG + Intergenic
1201277111 Y:12309546-12309568 GCCTCTGCCTCCCCAACTGCTGG - Intergenic
1201365069 Y:13195911-13195933 GCCTCAGCCTTGCCAAGTGCTGG + Intergenic
1201429025 Y:13887084-13887106 GCCTCTGCCTTGCAAAGTGCTGG + Intergenic