ID: 1062516475

View in Genome Browser
Species Human (GRCh38)
Location 9:136939481-136939503
Sequence GGTGGCGCAGCCTCTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062516463_1062516475 23 Left 1062516463 9:136939435-136939457 CCAGCTGGAGACCAGGAGTTGGC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG No data
1062516467_1062516475 12 Left 1062516467 9:136939446-136939468 CCAGGAGTTGGCAGGGCAGAGGC 0: 1
1: 0
2: 14
3: 67
4: 500
Right 1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG No data
1062516461_1062516475 24 Left 1062516461 9:136939434-136939456 CCCAGCTGGAGACCAGGAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 336
Right 1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062516475 Original CRISPR GGTGGCGCAGCCTCTCTCGG TGG Intronic
No off target data available for this crispr