ID: 1062516709

View in Genome Browser
Species Human (GRCh38)
Location 9:136940569-136940591
Sequence GGCCCTGGACGGTGGCCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 275}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062516709_1062516719 5 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516719 9:136940597-136940619 GGACCAGCCGAAGGTGCCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 133
1062516709_1062516714 -4 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516714 9:136940588-136940610 GGCCCCACAGGACCAGCCGAAGG 0: 1
1: 0
2: 2
3: 5
4: 166
1062516709_1062516718 4 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516718 9:136940596-136940618 AGGACCAGCCGAAGGTGCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 128
1062516709_1062516724 20 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516724 9:136940612-136940634 GCCCCGGGCCGAGGCCAGCTGGG 0: 1
1: 0
2: 3
3: 31
4: 289
1062516709_1062516721 11 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516721 9:136940603-136940625 GCCGAAGGTGCCCCGGGCCGAGG 0: 1
1: 0
2: 1
3: 11
4: 148
1062516709_1062516723 19 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516723 9:136940611-136940633 TGCCCCGGGCCGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 231
1062516709_1062516728 25 Left 1062516709 9:136940569-136940591 CCACTGGGCCACCGTCCAGGGCC 0: 1
1: 0
2: 2
3: 15
4: 275
Right 1062516728 9:136940617-136940639 GGGCCGAGGCCAGCTGGGTCAGG 0: 1
1: 0
2: 8
3: 58
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062516709 Original CRISPR GGCCCTGGACGGTGGCCCAG TGG (reversed) Exonic