ID: 1062516740

View in Genome Browser
Species Human (GRCh38)
Location 9:136940675-136940697
Sequence TGGGGTACACAGGATACTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062516740_1062516759 22 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516759 9:136940720-136940742 GCCTTGGGCTCCATCTGCACTGG 0: 1
1: 1
2: 1
3: 22
4: 233
1062516740_1062516757 7 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516757 9:136940705-136940727 CAGGAGGCCGAGGGGGCCTTGGG 0: 1
1: 0
2: 3
3: 33
4: 393
1062516740_1062516751 -2 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516751 9:136940696-136940718 CAAGTTGCCCAGGAGGCCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 330
1062516740_1062516752 -1 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516752 9:136940697-136940719 AAGTTGCCCAGGAGGCCGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 237
1062516740_1062516756 6 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516756 9:136940704-136940726 CCAGGAGGCCGAGGGGGCCTTGG 0: 1
1: 0
2: 9
3: 65
4: 566
1062516740_1062516753 0 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516753 9:136940698-136940720 AGTTGCCCAGGAGGCCGAGGGGG 0: 1
1: 3
2: 121
3: 2212
4: 19042
1062516740_1062516750 -3 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516750 9:136940695-136940717 CCAAGTTGCCCAGGAGGCCGAGG 0: 1
1: 0
2: 12
3: 506
4: 12009
1062516740_1062516746 -9 Left 1062516740 9:136940675-136940697 CCCCCAGTATCCTGTGTACCCCA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1062516746 9:136940689-136940711 TGTACCCCAAGTTGCCCAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062516740 Original CRISPR TGGGGTACACAGGATACTGG GGG (reversed) Exonic
900765295 1:4500938-4500960 AGGGGTGCTCAGGATGCTGGTGG - Intergenic
902174988 1:14642516-14642538 AGTGGAACAGAGGATACTGGAGG + Intronic
903879703 1:26500539-26500561 TGGGGTCCGCCGGATAATGGGGG - Intergenic
907445700 1:54506437-54506459 TGGGGTACACAGGAGAGGGGTGG + Intergenic
911088673 1:94000770-94000792 TGGAGAACACAGGATCCAGGTGG + Intronic
911435029 1:97845571-97845593 TGAGGTACGCAGGCTACTGGAGG - Intronic
911748081 1:101463444-101463466 AGGGGAACACATGATACTGTTGG + Intergenic
914850397 1:151309842-151309864 TGGGAGAAACAGGATCCTGGGGG + Intronic
917971333 1:180210031-180210053 TGGGGTCTACAGGATGATGGTGG - Intergenic
921674525 1:217963295-217963317 TGGGGAAAAGAGGAAACTGGGGG + Intergenic
922923186 1:229326439-229326461 TGGGGTTCACAAGTTCCTGGGGG - Intronic
923410202 1:233700595-233700617 TGGGGTAGAAAGGAGGCTGGGGG - Intergenic
1062972565 10:1660118-1660140 GGGTGGACACAGGATACTGGAGG - Intronic
1063200585 10:3782813-3782835 TGGGCTACACAGGAAATGGGTGG - Intronic
1063511981 10:6654588-6654610 TGGGTTATACAAGATACTGCAGG + Intergenic
1067429658 10:46234646-46234668 TGGGTTACAGAGGTAACTGGGGG - Intergenic
1069770922 10:70899460-70899482 TGGGGTTGAGAGGATACAGGGGG - Intergenic
1071465520 10:85936086-85936108 TGGGGTGCACAGGATATTATGGG + Intronic
1071861939 10:89683021-89683043 TGGGGTAAACAAAATACTGTGGG + Intergenic
1072200950 10:93158407-93158429 TGGGGTAAGCAGGGAACTGGTGG - Intergenic
1074434009 10:113418371-113418393 TGGGGGTAACAGGATAATGGAGG - Intergenic
1075125427 10:119695220-119695242 TGAGGTACACAGACAACTGGAGG + Intergenic
1077776049 11:5272700-5272722 TGGGGTCCACAGAACACTAGGGG - Intronic
1082625794 11:55483795-55483817 TGGGGTACAGGTGGTACTGGTGG + Intergenic
1083842623 11:65313574-65313596 TGGGGGAGGCAGGATGCTGGGGG - Intergenic
1089591951 11:119547300-119547322 TGGGGTACACAGACAAGTGGAGG - Intergenic
1091909848 12:4220735-4220757 TGGGCAACAGAGGAGACTGGAGG - Intergenic
1094389039 12:29928964-29928986 TGGGGTGCAGTGGGTACTGGAGG - Intergenic
1097078546 12:56412791-56412813 TGAGGTACACAGACAACTGGAGG + Intergenic
1098127846 12:67318819-67318841 AGGTATACACGGGATACTGGGGG + Exonic
1099557624 12:84129102-84129124 TGAGGTACACAGAAAACTGGAGG - Intergenic
1101787993 12:107903011-107903033 AGGGCTACACAAGATGCTGGAGG - Intergenic
1103860253 12:124006748-124006770 TCGAGTGCACAGGATGCTGGGGG + Intronic
1107392775 13:39984303-39984325 AGTGGAACAGAGGATACTGGAGG + Intergenic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1108956344 13:56163088-56163110 TGGGGTACACAGGATAGGTGAGG + Intergenic
1109478689 13:62919310-62919332 TGAGGTACACGGAAAACTGGAGG + Intergenic
1109944854 13:69420291-69420313 TGAGGTACAGAGAAAACTGGAGG + Intergenic
1110874910 13:80496945-80496967 TGGAGAACACACGATACTTGTGG + Intergenic
1111597338 13:90428283-90428305 TGAGGTACACAGGCAACTGGAGG - Intergenic
1115079498 14:29433927-29433949 TGGAGAACACAGGAAGCTGGTGG + Intergenic
1117990569 14:61428990-61429012 TGTGGAACACAGGATAATGATGG - Intronic
1120055862 14:79923539-79923561 TAGGCTACACAGGATTGTGGTGG - Intergenic
1121926108 14:97928717-97928739 AGGGGCACCCAGGATACTGTGGG - Intronic
1122812173 14:104294446-104294468 TGGGGGACACAGGCTAATTGCGG + Intergenic
1123923581 15:25087862-25087884 TGGGGGTCACAGGAGAGTGGTGG + Intergenic
1123923754 15:25089004-25089026 TGGGGGTCACAGGAGAGTGGTGG + Intergenic
1124905518 15:33864566-33864588 TGGGTGACACAGGAGCCTGGAGG + Intronic
1125547792 15:40519989-40520011 TGGGGTAAAAGGGAAACTGGGGG - Intergenic
1131164111 15:90129832-90129854 TGGGGGACTGAGGATAGTGGAGG + Intergenic
1133073513 16:3262678-3262700 AAGGGTAGACTGGATACTGGCGG + Intergenic
1136680177 16:31956220-31956242 TGGGGTGCTCAGGATATTAGGGG + Intergenic
1136889888 16:33961884-33961906 TGGGGTGCTCAGGATATTAGGGG - Intergenic
1137343959 16:47637249-47637271 TGAGGTACACAGACAACTGGAGG - Intronic
1203083146 16_KI270728v1_random:1161730-1161752 TGGGGTGCTCAGGATATTAGGGG + Intergenic
1143701795 17:8666064-8666086 TGGGGTACACAGGGCAGTAGGGG - Intergenic
1147035506 17:37676891-37676913 TGGGGAGCAGAGGATAGTGGAGG - Intergenic
1148910289 17:50938921-50938943 TGGGGTACCCAGTATGTTGGAGG - Intergenic
1151278749 17:73056030-73056052 TGGGGCACAGAGGACACTGCTGG + Intronic
1153588077 18:6644572-6644594 TTGGTTTCACAGGATACTGATGG - Intergenic
1155912290 18:31517864-31517886 TGGGGTACATTACATACTGGTGG + Intronic
1160269480 18:77371591-77371613 TGGGGTAAAAAGGATGCTGTTGG - Intergenic
1161402494 19:4073839-4073861 TGGAGTGCAGAGGATACTGACGG - Intergenic
1161562003 19:4978615-4978637 TGGGGTACGCAGGACACCCGTGG - Intronic
1162231663 19:9271427-9271449 TGAGGTACGCAGGCAACTGGAGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1167904100 19:52644035-52644057 TGGGGAACACGGGAAGCTGGTGG + Intronic
1167910926 19:52700993-52701015 TGGGGAACACGGGAAGCTGGTGG + Intergenic
1167934025 19:52891715-52891737 TGGGGAACACGGGAAGCTGGTGG + Intronic
1167964091 19:53129313-53129335 TGGGGAACACAGGAAGCTGGTGG + Intronic
1168000970 19:53445836-53445858 TGGGGAACACGGGAAGCTGGTGG - Intronic
1168005335 19:53482335-53482357 TGGGGAACACGGGAAGCTGGTGG - Intronic
928228333 2:29475014-29475036 GGGGGTACACAGGAGCCTGGCGG - Intronic
928637928 2:33266798-33266820 TGAGGTATACAGAAAACTGGAGG - Intronic
929841817 2:45474531-45474553 TTGGATTCACAGTATACTGGAGG + Intronic
931356311 2:61539842-61539864 TGGGGAACCCAGGATACAGAGGG - Intergenic
931500136 2:62856101-62856123 TGAGGTACACAGGCAAGTGGAGG - Intronic
932559852 2:72857566-72857588 TTGGGAACACAGGGGACTGGGGG - Intergenic
935214631 2:100966273-100966295 GGATGTACACAGCATACTGGGGG + Intronic
935305335 2:101731625-101731647 TGGTGTACACCAGCTACTGGAGG + Intronic
937419649 2:121743069-121743091 ATGGGTACACTGCATACTGGTGG - Intronic
938930877 2:136086071-136086093 TGGGGATCACAGGATAATGCAGG + Intergenic
940422794 2:153499185-153499207 TGAGGTACACAGACAACTGGAGG + Intergenic
942618723 2:177824201-177824223 TGGGGAACACAGGAAATTTGAGG + Intronic
943306003 2:186263749-186263771 TGTGGTGAACAGGATAATGGTGG - Intergenic
943827531 2:192414562-192414584 TGAAGTACACAGGCAACTGGAGG - Intergenic
946052342 2:216873994-216874016 TGAGGTATAAAGGATAATGGTGG - Intergenic
946226111 2:218264939-218264961 TAGGGGACACAGGATCCTTGGGG - Intronic
947887417 2:233584704-233584726 AGGGGTGCTCAGGATACTGGGGG + Intergenic
948041608 2:234905838-234905860 TGGGGTACACAGGGAGCTCGGGG - Intergenic
1169949868 20:11032111-11032133 TGGGGTATAAAGGATGCTTGAGG + Intergenic
1170952765 20:20951725-20951747 TGTTGTACACAGGATCCTAGGGG + Intergenic
1171364331 20:24613529-24613551 TGGGGGACACAGGAGGCTTGGGG - Intronic
1172004804 20:31811790-31811812 TGCGGTAGAAAGGACACTGGAGG - Intergenic
1172773476 20:37394626-37394648 TGGGCTGCACTGGATGCTGGAGG + Intronic
1173224324 20:41153044-41153066 TGGGGTCCACAGGCCACAGGTGG + Intronic
1173808368 20:45940852-45940874 TGGGGTTCCTGGGATACTGGGGG - Exonic
1175895922 20:62335559-62335581 TGGGGTACAGGGGTTCCTGGGGG - Intronic
1177037347 21:16060481-16060503 TGAGGTACACAGACAACTGGAGG + Intergenic
1177231708 21:18330195-18330217 TGGGGTTCAAAGGATGTTGGAGG - Intronic
1178549873 21:33527736-33527758 TGGGGTGCACTGTAAACTGGGGG + Intronic
1181039260 22:20184254-20184276 TGGGGTACATAGGGGACTGTGGG - Intergenic
1181039325 22:20184444-20184466 TGGGGTACATAGGGGACTGTGGG - Intergenic
1181531990 22:23522156-23522178 TGGGGGGCCCAGGATACAGGCGG - Intergenic
1181828047 22:25535722-25535744 CGGGGTACACTAGACACTGGAGG + Intergenic
1182919325 22:34064925-34064947 TGGGGTACACAGGCAAAGGGAGG - Intergenic
1183063318 22:35348324-35348346 TGGGGTGCACAGGCCACAGGAGG + Intergenic
949474103 3:4426135-4426157 AGGGGTAAACAGAATACAGGAGG + Intronic
949942200 3:9163602-9163624 TGGGGTACACAGGAAAAAGGTGG + Intronic
950015266 3:9750491-9750513 TGGGGTACAAAGGAATTTGGGGG + Intronic
952676322 3:36035296-36035318 TGGGGTACACAGAACAATGCTGG - Intergenic
952821675 3:37491522-37491544 CTGGGAACACAGGAGACTGGAGG + Intronic
955849327 3:63203265-63203287 TAGGGACCACACGATACTGGGGG - Intergenic
956200950 3:66705319-66705341 TGGCATACACTGGAGACTGGTGG + Intergenic
962339283 3:134568438-134568460 TGGGTTACACAGGAACCTGCAGG - Intronic
963250246 3:143096140-143096162 TGAGATACACAGAAAACTGGAGG - Intergenic
968838284 4:2981339-2981361 TGAGGTACACAGACAACTGGAGG + Intronic
969136490 4:5033333-5033355 TGGAGTCCACAGGAACCTGGAGG - Intergenic
976815262 4:89140288-89140310 TGGGGCCCGCAGGATGCTGGGGG + Intergenic
977709329 4:100106791-100106813 GAGGATACACAGGAGACTGGTGG + Intergenic
982372834 4:154653418-154653440 TGTGGTACTCAGGGTACTGGTGG + Intronic
984325261 4:178242511-178242533 TGAGGTACACAGAAAAGTGGAGG - Intergenic
986105819 5:4658413-4658435 TGAGGTACATGGGATATTGGTGG + Intergenic
988870004 5:35378861-35378883 TCAGGAACACAGGATATTGGAGG - Intergenic
989425390 5:41290539-41290561 TGAGGTACACAGACAACTGGAGG + Intergenic
992520530 5:77545878-77545900 TGGGGGACAGAGGCTACTGGGGG + Intronic
1000504891 5:162103943-162103965 TGGGCGACACAAGATCCTGGAGG + Exonic
1002677983 5:180934924-180934946 TGTGGTACACAGACAACTGGAGG + Intronic
1003140649 6:3468640-3468662 TGGGGTGGACAGGACACTGCTGG - Intergenic
1006155443 6:32010730-32010752 AGGTGTCCACAGGATTCTGGGGG + Intergenic
1006161749 6:32043464-32043486 AGGTGTCCACAGGATTCTGGGGG + Exonic
1006339011 6:33435766-33435788 TGGGGGACTCAGAATAATGGGGG - Intronic
1007194681 6:40050420-40050442 TGGGGGAATCAGCATACTGGGGG - Intergenic
1008154456 6:47996497-47996519 TGGGGTGCAGAGGGTACTGCGGG - Intronic
1008730169 6:54472778-54472800 TGGAGTACAATGAATACTGGAGG + Intergenic
1009870871 6:69451120-69451142 TGAGGTACACAGACAACTGGAGG + Intergenic
1011640760 6:89413940-89413962 TGGGAGACACAGGAGAGTGGAGG - Intergenic
1011673480 6:89707819-89707841 TGAGGTACACACTATACTTGTGG + Intronic
1011753441 6:90476101-90476123 TGGGGTATACAGGAAACTGGTGG - Intergenic
1015784748 6:136911104-136911126 AGGGGTAAAAAGGAAACTGGGGG - Intronic
1019333399 7:471343-471365 AGGGGTGCACAGGATCCTGGCGG - Intergenic
1019706246 7:2498525-2498547 TGGGGTACCCAGGGTAGGGGAGG + Intergenic
1020261141 7:6531323-6531345 TGGGGTGCAGCGGAAACTGGCGG + Intronic
1021097299 7:16548231-16548253 TGAGGTACACAGACAACTGGAGG - Intronic
1023699468 7:42878209-42878231 TGAGGTACACAGAAAAGTGGAGG - Intergenic
1026776268 7:73232959-73232981 TGGGGAACACAGAATTCTAGCGG + Intergenic
1027017122 7:74786328-74786350 TGGGGAACACAGAATTCTAGCGG + Intronic
1027070903 7:75159604-75159626 TGGGGAACACAGAATTCTAGCGG - Intergenic
1027995839 7:85424277-85424299 TGAGGTACACAGAAAACTGGAGG - Intergenic
1032463791 7:132130691-132130713 AGGGGCACACAGGACACTGCGGG + Intronic
1032858561 7:135857672-135857694 TGAGGTACACAGAAAAGTGGAGG + Intergenic
1034471072 7:151254608-151254630 TGGGGAACACAGGACACACGTGG - Intronic
1035280089 7:157772946-157772968 GGGTGTACACTGGGTACTGGCGG + Intronic
1036800352 8:11786357-11786379 CGGGGTACAGAGGATAGTGTGGG + Exonic
1041351107 8:56948329-56948351 TGGGGTCCCCATGTTACTGGTGG - Intergenic
1041404985 8:57488328-57488350 TGGGGTCTACAGGATGGTGGAGG + Intergenic
1043399630 8:79871481-79871503 TGGGCTGCACAGGATTCTGGGGG - Intergenic
1045873419 8:106950725-106950747 TGAGGTACACAGACAACTGGGGG - Intergenic
1049268505 8:141682048-141682070 GGGGAGACACAGGATAGTGGGGG + Intergenic
1049763573 8:144342437-144342459 AGGGGGACACAGGAGACTGAGGG - Intergenic
1053301794 9:36957650-36957672 TGGGATAAACAGGATGCTCGTGG - Intronic
1057499779 9:95587520-95587542 TGGAGTACACAGCACACTGGTGG + Intergenic
1058027005 9:100152100-100152122 TTGAGTACACAAGGTACTGGAGG - Intronic
1060702786 9:125773425-125773447 GGGGGAACACAGGATACTACTGG - Intronic
1062142934 9:134969781-134969803 TGGGGGACCCAGGATGCAGGGGG - Intergenic
1062516740 9:136940675-136940697 TGGGGTACACAGGATACTGGGGG - Exonic
1062612240 9:137380434-137380456 TGGGGTGCGGGGGATACTGGCGG - Intronic
1186223577 X:7374891-7374913 TGAGGTACACAGACAACTGGAGG + Intergenic
1187981970 X:24767168-24767190 TGGCTTACACAGGCTACTAGTGG - Intronic
1191953748 X:66622342-66622364 TGAGGTACCCAGGCTGCTGGGGG + Intronic
1196500349 X:116373487-116373509 TGAGGTACAGGGAATACTGGTGG + Intergenic
1197516908 X:127443609-127443631 TGGGGTACAGAGGATGTTTGGGG - Intergenic
1199359967 X:146906716-146906738 TGAGGTACACAGAAAAGTGGAGG + Intergenic