ID: 1062517595

View in Genome Browser
Species Human (GRCh38)
Location 9:136944188-136944210
Sequence CGTCCCGCCGGGAGTTCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062517581_1062517595 24 Left 1062517581 9:136944141-136944163 CCGGGAAGGGAGGCCGAGAGCGG 0: 1
1: 0
2: 3
3: 14
4: 187
Right 1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1062517584_1062517595 11 Left 1062517584 9:136944154-136944176 CCGAGAGCGGGCGTCCTGTTCCT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1062517585_1062517595 -3 Left 1062517585 9:136944168-136944190 CCTGTTCCTCCAGCCCCAACCGT 0: 1
1: 0
2: 2
3: 16
4: 311
Right 1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1062517579_1062517595 30 Left 1062517579 9:136944135-136944157 CCAGGCCCGGGAAGGGAGGCCGA 0: 1
1: 1
2: 1
3: 23
4: 220
Right 1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1062517586_1062517595 -9 Left 1062517586 9:136944174-136944196 CCTCCAGCCCCAACCGTCCCGCC 0: 1
1: 0
2: 2
3: 39
4: 459
Right 1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1062517580_1062517595 25 Left 1062517580 9:136944140-136944162 CCCGGGAAGGGAGGCCGAGAGCG 0: 1
1: 0
2: 3
3: 19
4: 219
Right 1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062517595 Original CRISPR CGTCCCGCCGGGAGTTCCAC GGG Intronic
918114730 1:181485932-181485954 CGGGCCGCCGGGAGTTTCAGCGG - Intronic
920972186 1:210752409-210752431 CGTCAAGCAGAGAGTTCCACTGG + Intronic
1064349719 10:14565945-14565967 CGCCCTGCTGCGAGTTCCACAGG - Intronic
1065981496 10:30902750-30902772 CGGCCCGGTGGGAGATCCACTGG - Intronic
1076185071 10:128440485-128440507 CCTCCCTCCGGGAGCTCAACAGG - Intergenic
1080887145 11:36377284-36377306 CGTCCCGGCGGGATCCCCACTGG - Intronic
1088084504 11:105960660-105960682 CCTCCCCCCGGGAGTTCCGTAGG + Intronic
1114705918 14:24726640-24726662 CCTCCCCCGGGGAGTTCCATAGG - Intergenic
1125468239 15:39976469-39976491 CGGCCAGCCGGCAGTTCCGCAGG + Exonic
1127931497 15:63600261-63600283 CGTCCCGCCGGGACATTCAGGGG + Intronic
1136288293 16:29257128-29257150 CGTGCCCCCGGGAGAGCCACCGG - Intergenic
1136400139 16:30012337-30012359 CCACCAGCAGGGAGTTCCACTGG + Intronic
1139088501 16:63617308-63617330 AGTCCCGCGGTGAGTGCCACTGG - Intergenic
1141563360 16:84884935-84884957 GGTCCCTCCTGGCGTTCCACTGG + Intronic
1142352620 16:89587029-89587051 CCGCCGGCCGGAAGTTCCACAGG + Exonic
1145111840 17:20170512-20170534 CACCCCCCTGGGAGTTCCACTGG - Intronic
1161963629 19:7535873-7535895 CGTCCCGCCGAGCCTTCCCCGGG - Exonic
1163211935 19:15847282-15847304 CGTGCCGGCAGGTGTTCCACTGG + Intergenic
1168578934 19:57537112-57537134 CGTCCCTCCCTGTGTTCCACAGG + Intronic
925447545 2:3940895-3940917 CCTCCCCCTGGGAGTTCCGCAGG + Intergenic
926224556 2:10957758-10957780 CCTCCTGCCAGGAGTCCCACTGG - Intergenic
927552804 2:24013678-24013700 CGTCCCGCCGCGGGTTGGACAGG - Intronic
1172360752 20:34311393-34311415 CTTCCCGCCAGAAGCTCCACTGG - Intronic
1175349885 20:58310026-58310048 GGTCCGGCCGGGAGGGCCACGGG + Intronic
1184107900 22:42379075-42379097 CATCCCCCAGTGAGTTCCACAGG - Intergenic
952453589 3:33453121-33453143 CGACCCGCTGGCACTTCCACTGG + Intergenic
958522278 3:95204845-95204867 CCTCCCGCCAGGAGCTCCACAGG + Intergenic
959031146 3:101300425-101300447 CCTCCCGCGGGGAGCTCCGCAGG + Intronic
969689080 4:8694434-8694456 CTTCCACCCGGGAGTCCCACTGG - Intergenic
999142923 5:149374553-149374575 CGTGCCTCCGGCAGGTCCACGGG + Exonic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1021478418 7:21088851-21088873 AGTCCCACTGGAAGTTCCACTGG + Intergenic
1033159262 7:138981733-138981755 GGTCCCGCCGCGCGTTCCCCGGG + Intergenic
1042805794 8:72769585-72769607 CGACCCTCAGGGAGTTCCACTGG + Intronic
1061873724 9:133533941-133533963 GGGCCCGCCGGGAGTTTCCCAGG + Intronic
1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG + Intronic