ID: 1062517971

View in Genome Browser
Species Human (GRCh38)
Location 9:136945561-136945583
Sequence TGGGGGGTGTAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 1, 2: 4, 3: 55, 4: 619}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062517971 Original CRISPR TGGGGGGTGTAGAGGGAAGC AGG Intronic
900001393 1:16779-16801 TGTGGGGTGTCTAGGGAAGAAGG + Intergenic
900204839 1:1427422-1427444 GGAGGGGTGGAGAGGGGAGCGGG - Intronic
900345875 1:2210033-2210055 TGGGGGGTCCTGAGGGGAGCTGG + Intronic
900605901 1:3523418-3523440 AGGGAGGGTTAGAGGGAAGCAGG - Intronic
900725845 1:4215986-4216008 TGGGAGGTGGAGAGAGAGGCAGG - Intergenic
900751495 1:4400740-4400762 TGGGGGATGGAGTGGGAAGGTGG + Intergenic
901021821 1:6259994-6260016 TGGGCGGGGAAGTGGGAAGCCGG - Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901449517 1:9327425-9327447 TCTGGGGTGTAAAGGGAAGGGGG + Intronic
901744088 1:11361133-11361155 AGGGGGTTGTAGTGGGAATCTGG + Intergenic
901930918 1:12595737-12595759 TGGGGGCTGTGGAGAGGAGCTGG + Intronic
902466231 1:16620334-16620356 TGCAGGGTGCAGAGGGAAACAGG + Intergenic
902633929 1:17722683-17722705 TGGGGAGTGTGGAGTGATGCAGG + Intergenic
902638657 1:17751747-17751769 TGGTGGGTGTAGAGGGCACAGGG - Intergenic
902926884 1:19701729-19701751 TGGGGGGTGAAGAGGAGAGGGGG + Intronic
903034091 1:20483889-20483911 TGGGTGGTTCAGAGGAAAGCAGG - Intronic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903878533 1:26492790-26492812 TGGGGGGTGTGGTGGGAGACAGG + Intergenic
904204979 1:28848384-28848406 TGGGGAGTGTGGAGGGACCCTGG - Intronic
905357764 1:37396614-37396636 TGTGGCGTGGAGAGGGGAGCTGG - Intergenic
905526191 1:38641807-38641829 TGGGGGATGGAGTGGGAAGGTGG + Intergenic
905696853 1:39980852-39980874 TGGGTGGCGTAGGAGGAAGCTGG + Intergenic
905878228 1:41447118-41447140 TGTGGGGGGTAGAGGGATGCAGG + Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906519057 1:46456640-46456662 AGCGAGGAGTAGAGGGAAGCAGG + Intergenic
907399566 1:54216539-54216561 TGGAGGGTGCAAAGGGAAGCAGG - Intronic
907644796 1:56231546-56231568 TGGGTGGTGGAGAGGGGTGCTGG + Intergenic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
908775042 1:67631700-67631722 CTGGGCGTGTAGAGGGAAGCTGG + Intergenic
909010861 1:70333462-70333484 TGGGGGTAGGAGAGGGAATCAGG - Intronic
909075779 1:71048456-71048478 TGGGTGGTGGGGAGGGGAGCGGG - Intergenic
910547843 1:88439290-88439312 TGGGAAGGGTAGTGGGAAGCAGG + Intergenic
910625894 1:89306002-89306024 TGGGTGGTGTAGAGGAAAGCTGG - Intergenic
911723802 1:101220238-101220260 TGGGGAGAATTGAGGGAAGCAGG + Intergenic
911782835 1:101904832-101904854 TGTGGGGAGTAGAGGTAAACAGG - Intronic
912211348 1:107560562-107560584 AGGGGGGTGGGAAGGGAAGCAGG + Intergenic
912551937 1:110490321-110490343 TGGGGGGTGGGGGAGGAAGCTGG - Intergenic
912659226 1:111513725-111513747 TGGGTGGGGTAGAGGGAGGGAGG - Intronic
912804571 1:112744891-112744913 TGGGGTGAGTAGAGGGACACAGG - Intergenic
913070002 1:115290132-115290154 TGAGGGGAGTAGAAGGAGGCAGG - Intronic
913264945 1:117034851-117034873 ATGGAGGTGTAGGGGGAAGCAGG - Intronic
915083364 1:153367194-153367216 GGGAGGGGGTAGAGGGGAGCCGG + Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915229202 1:154433140-154433162 TGGGTGGTGTTGGGGGAAGGAGG + Intronic
915353870 1:155244000-155244022 TGAGGGGTGGAGTGGGAAGAAGG - Intronic
916442045 1:164836672-164836694 TGGGAGATATAGTGGGAAGCAGG - Intronic
916793719 1:168146258-168146280 TGGGAGGAGAAGAGGGAAGTGGG + Intergenic
917443155 1:175084364-175084386 TGGGGGATGTGGAGGGGGGCAGG + Intronic
919384119 1:196897578-196897600 TGGGGGATGGAGTGGGAAGGTGG + Intronic
919819330 1:201463083-201463105 TGGAGGGTGGAGGGGGAAGCAGG - Intergenic
919827784 1:201516037-201516059 TGGGGGTAATACAGGGAAGCAGG + Intergenic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
921412918 1:214855469-214855491 TGGGGGGTGGAGAAAGAAGAGGG - Intergenic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
922494808 1:226048148-226048170 TGGGGGGTGGTGGGGGAAGTGGG - Intergenic
922551507 1:226497758-226497780 TGGGAGGTGGGGAGGGAACCAGG - Intergenic
923094886 1:230767401-230767423 TGGGTGGTGTGGAAGGAAGACGG - Intronic
923447887 1:234089452-234089474 TGGTGGGTGTTGAGTGCAGCTGG + Intronic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
1063362475 10:5469563-5469585 TGGCGGGGGTTGAGGGGAGCTGG - Intergenic
1063594384 10:7420620-7420642 AGGGGGTTGTAGATGGAAGCAGG - Intergenic
1063623278 10:7667410-7667432 TGGGGGGTGTCCAGGGAGGCAGG - Intergenic
1063932988 10:11048082-11048104 TGGGGAGTGTTGAGGGGAGGAGG - Intronic
1064680439 10:17806407-17806429 TGGGGAGTGGAGTGGGAAGGTGG + Intergenic
1066104517 10:32145059-32145081 TGGGGTGGGGAGAGGGAATCTGG + Intergenic
1066211348 10:33242129-33242151 TGGGGGGAGTAAAAGGAGGCAGG - Intronic
1066372511 10:34829390-34829412 TGGGTGGTGGGGCGGGAAGCTGG + Intergenic
1066650560 10:37651207-37651229 TGGTGGTTGGAGAGGGAGGCAGG + Intergenic
1067103833 10:43351652-43351674 TGGGGGGTGTGGAGGGGGCCTGG - Intergenic
1067295993 10:44975446-44975468 TGGGAGGTGGAGAGGGGAGTGGG - Intronic
1067661046 10:48236431-48236453 TGGAGGGTGGCGAGGGAAGTGGG - Intronic
1068051862 10:51960494-51960516 TGGGGGGTGTGGTGGGGAGGGGG - Intronic
1068936226 10:62638084-62638106 TGGGGGAAGTGAAGGGAAGCGGG + Intronic
1069664277 10:70144670-70144692 TGGGGGGAGTGGAAGGAATCTGG + Intronic
1070574432 10:77666865-77666887 TGGTGGGTGGAGAGGGAAATTGG - Intergenic
1071761569 10:88613498-88613520 TGGAGAGTGTATAGGGAAGAGGG + Intergenic
1072005226 10:91239123-91239145 TGGGGGGCGGAGGGGGAGGCAGG + Intronic
1072377345 10:94831006-94831028 TGGGGGGTGAGAAGGGAAGTAGG - Intronic
1072539652 10:96388693-96388715 AGGGCAGGGTAGAGGGAAGCTGG - Intronic
1072945794 10:99808915-99808937 TGGAGGGTGTAAAGAAAAGCTGG + Intronic
1073177106 10:101563344-101563366 TGCGGGGTGGAGAGGGTTGCTGG - Intergenic
1073344929 10:102775962-102775984 TGGGGGCTGCAGATGGGAGCAGG - Intronic
1073471601 10:103725969-103725991 TTGGGGGTGTAGGGTGAGGCCGG + Intronic
1074610507 10:115016829-115016851 TGGAGGGGGTGGTGGGAAGCTGG + Intergenic
1075263171 10:120980107-120980129 AGGGGGGTGCAGAGGGTCGCCGG + Intergenic
1075708930 10:124520283-124520305 TGGAGGGTGAAGAGGGGAGGAGG - Intronic
1075736770 10:124669087-124669109 TGGGGGGTGTAGGGGGTAGAAGG + Intronic
1075747752 10:124739719-124739741 TGGGGGCTGCACGGGGAAGCTGG - Intronic
1075927509 10:126264848-126264870 TGGGGTGAGAACAGGGAAGCAGG - Intronic
1076447966 10:130531440-130531462 TGGGGTGTGGAGAGTGAGGCTGG + Intergenic
1077241555 11:1512994-1513016 TGGGGGGTGATTAGGGATGCGGG + Intergenic
1077307006 11:1872977-1872999 GTGGGGGTATAGGGGGAAGCAGG + Intronic
1077555705 11:3225163-3225185 TGGGGAGGGGATAGGGAAGCTGG + Intergenic
1078532886 11:12150638-12150660 TGGAGGATATAGAGGGATGCTGG - Intronic
1078548984 11:12267553-12267575 TGAGGGGTGAAGGGAGAAGCAGG - Intergenic
1078733777 11:14001101-14001123 TGGGGGGTGGAGGAGGAAGGAGG - Intronic
1079243201 11:18735288-18735310 GAGGGGGTGTAGAGGGTGGCAGG + Intronic
1079766977 11:24406266-24406288 AGGGGGATGAAGAGGGAAGACGG - Intergenic
1080425340 11:32149453-32149475 GGGGTGGTGGAGAGGGAAGACGG - Intergenic
1080665124 11:34329362-34329384 AGGGGGGTGGAGTGGGAAGTGGG - Intronic
1080820016 11:35796700-35796722 TGGGGGGAGGAAAGGGAAGCTGG + Intronic
1080953965 11:37071098-37071120 TGGGGGGTCTTGGGGGAAGAAGG - Intergenic
1082834014 11:57639106-57639128 TGTGGGGTGTTGAGGGGTGCGGG + Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083206448 11:61152497-61152519 TGGGGGGTGTAGAAGAGGGCTGG - Intronic
1083313695 11:61800791-61800813 TGTGGGTTGGAGGGGGAAGCGGG + Exonic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083719699 11:64598208-64598230 TGTGGGGTCTGGAGGGAGGCAGG + Intronic
1084129002 11:67119187-67119209 GGGGGGGTGGAGAGGCGAGCTGG + Intergenic
1084496947 11:69510706-69510728 TGGGCGGGGGAGGGGGAAGCTGG - Intergenic
1084662518 11:70554535-70554557 AGGGGGGAGGAGAGGGAATCTGG - Intronic
1084960593 11:72714200-72714222 AGGGAGGTGGAGAGGGAGGCTGG + Exonic
1085013600 11:73158069-73158091 TGGGGGGGGTGGTGGGAAGATGG + Intergenic
1085238188 11:75031380-75031402 TGGAGGGGGTAGATGGAGGCTGG - Intergenic
1085256235 11:75175127-75175149 TGGGGAGTGGGGAGGGAAGGGGG + Intronic
1085391777 11:76185814-76185836 TGTGGGGTGTAAGGGGAAGGAGG - Intergenic
1085658394 11:78338906-78338928 GTGGGGGTGTACAGGGAATCAGG - Intronic
1085932213 11:81097315-81097337 TGTTGGGTGTAGCGGGAAGCAGG + Intergenic
1086192935 11:84101941-84101963 TGGGGGGTAAAGTGTGAAGCTGG - Intronic
1086250960 11:84813857-84813879 TGAGAGGTGTAGAGGGAGGGGGG - Intronic
1087274210 11:96144397-96144419 TGAGGGGAGAAGAGGGAGGCAGG + Intronic
1087349142 11:97008906-97008928 TGGAGGGTGAAGAAGGAAGATGG - Intergenic
1089097472 11:115931202-115931224 TGGGGAGTTTGGGGGGAAGCGGG - Intergenic
1089497210 11:118913822-118913844 TGGGGAGGGTAGAGGGAGCCAGG + Intronic
1090089743 11:123684670-123684692 TGGCGGGTGGAGTGGGATGCGGG - Intergenic
1091374482 12:16894-16916 TGTGGGGTGTCTAGGGAAGAAGG + Intergenic
1091391013 12:125964-125986 TGGGGGCTGTCGAGGGTACCAGG + Intronic
1092049475 12:5457661-5457683 TGGGGTATCTATAGGGAAGCTGG - Intronic
1093278509 12:17159899-17159921 TGGGGTGGGTGGGGGGAAGCAGG - Intergenic
1093865950 12:24227608-24227630 TGGGGGGCGGTGAGGGAACCTGG + Intergenic
1094107903 12:26833110-26833132 TGGGGAGCGGAGAGGGAAGGAGG - Exonic
1095264506 12:40138247-40138269 TGGAGGGTGTAGTGGAAAGTGGG + Intergenic
1095625664 12:44311479-44311501 TGGTGGGTGTAGATGCAAACTGG + Intronic
1095626506 12:44320519-44320541 TGGGGGTAGGAGAGGGAAGGTGG - Intronic
1096086593 12:48869205-48869227 TGGTGTGTGTAGGGGGAGGCTGG - Intergenic
1096961381 12:55581628-55581650 TGGAGGGTGGAGAGGGAGGAGGG - Intergenic
1097099308 12:56575544-56575566 GGGGGGGTGTAGGGGTAAGGGGG - Intronic
1097166686 12:57089779-57089801 GGGGGGGTGACGAGGGAGGCAGG + Intronic
1097268003 12:57756678-57756700 TGGGGGGATTAGAGGGGAGAAGG - Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1098300884 12:69053160-69053182 TGGGAGGTGTGGAGGGCAGGGGG + Intergenic
1098429936 12:70408108-70408130 GTGGGGGTGTAGATAGAAGCGGG + Intronic
1099304597 12:80937764-80937786 GCGGGGGTGGAGAGGGAAGACGG + Exonic
1100726736 12:97416880-97416902 TGGGGGGTGTGGGGGGAGGGGGG + Intergenic
1101284146 12:103292258-103292280 TGGGTGTTGCAGAGGAAAGCAGG + Intronic
1101577013 12:106007057-106007079 TGGGGGATGCAAAGGGAAGAGGG - Intergenic
1101664112 12:106793930-106793952 TGGGGGTGGGGGAGGGAAGCAGG + Intronic
1101886081 12:108663673-108663695 TGGGGAGAGTGGAGGGAGGCAGG + Intronic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102411761 12:112726111-112726133 TGGGGGGTGTACTGGGGAGTGGG + Intronic
1102566794 12:113802360-113802382 TGGGGGAGGTGGAGGGAAGGAGG + Intergenic
1102923254 12:116808591-116808613 TGGGGGGTGTGGAGCCAGGCGGG - Intronic
1103131840 12:118475735-118475757 TAGGGGAAGTAGAGGGAAGCTGG + Intergenic
1103173635 12:118843575-118843597 TGGGGGGTGTTGAGGACTGCAGG + Intergenic
1103364426 12:120370902-120370924 TGGGGTGGGGAGAGGGAAGGAGG - Intergenic
1103867142 12:124062313-124062335 TGGGGGCAGAAGAGGGAAGGAGG - Intronic
1103936921 12:124481852-124481874 TGAAGGGAGTAGAGGGAGGCAGG + Intronic
1104269682 12:127271991-127272013 TAGGCAGTGTTGAGGGAAGCAGG - Intergenic
1104667976 12:130660892-130660914 TGGGGCTTGTAGAGGGCAGGTGG - Intronic
1104845024 12:131842332-131842354 TGGGCGGTGTGGAGGGCAGCTGG - Intronic
1104947756 12:132424225-132424247 GCGGGGGAGTAGAAGGAAGCGGG + Intergenic
1104964560 12:132503103-132503125 TGGGGGGTGGGGTGGGAGGCGGG - Intronic
1105831356 13:24165314-24165336 TGGAGGGTGCAGATGGATGCTGG - Intronic
1106362581 13:29046050-29046072 TGGGGTGTCTAGATGGCAGCAGG - Intronic
1107307453 13:39037985-39038007 TGGGGGCTGTAGGGGTAACCAGG - Exonic
1107681057 13:42851054-42851076 TGGGGTGGGTAGAGAGGAGCAGG - Intergenic
1107793673 13:44028532-44028554 TGGCTGGGGTAGAGAGAAGCAGG + Intergenic
1108120238 13:47178044-47178066 TGGGATGTGTAGAGGGGAGGGGG - Intergenic
1108519479 13:51233551-51233573 TGGGGCGGGTAGGGGGAAGCGGG + Intronic
1108529448 13:51315300-51315322 TGTAGGGGGTTGAGGGAAGCAGG - Intergenic
1108533745 13:51350791-51350813 TGGGAGGTGGGGAGGGGAGCTGG - Intronic
1109194967 13:59368697-59368719 TGGGGAGATTAGAGGGGAGCAGG - Intergenic
1110486626 13:76051994-76052016 TGGGGTGTGTAGGGGGGAGGTGG - Intergenic
1110661831 13:78066191-78066213 TGGGGGATGGAGTGGGAAGATGG - Intergenic
1110856108 13:80298607-80298629 TGGGGGGTGGAGGGGGGGGCGGG + Intergenic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112450259 13:99501552-99501574 TAGGGGGTCAAGAGGGAAGGAGG - Exonic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1113489773 13:110682116-110682138 GGGGCGGTGTGGAGGGTAGCAGG + Intronic
1113573125 13:111372889-111372911 TGGGAGGTGAAAGGGGAAGCAGG - Intergenic
1113791499 13:113030975-113030997 TGGAGGGCGTACAGGGCAGCAGG + Intronic
1114453073 14:22838853-22838875 TGGGGGGAGGAGAGGGATGGGGG + Intronic
1114613500 14:24056598-24056620 TGGGGAGTGGAGAGAGAAACGGG - Intronic
1114658298 14:24329276-24329298 TGGGGGGTGGAGGGAGAAGGAGG - Intronic
1117018133 14:51539839-51539861 TGGGGGGAGTAGAGGAAGGTGGG + Intronic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118635758 14:67747638-67747660 TGGGGGGTGGTGGGGGGAGCGGG - Exonic
1118659559 14:67993333-67993355 TGGGGAGTGTAGCGGGATGGAGG - Intronic
1118837305 14:69485936-69485958 TGGGAGGTATTGAGGGAAGAGGG + Intronic
1119030473 14:71188351-71188373 TGGGGGGTGGTGAGGTATGCGGG + Intergenic
1120228597 14:81818500-81818522 TGGTGGGTGGAGAGAGAAGAAGG + Intergenic
1120312626 14:82850235-82850257 TGGGGTGAGTAGAGGAAAGAGGG + Intergenic
1120423901 14:84322916-84322938 TTTGTGGAGTAGAGGGAAGCAGG + Intergenic
1121489152 14:94345632-94345654 TGGGGTGTGGAGGGGAAAGCTGG + Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122076285 14:99237068-99237090 TGGGGGGTGTAGAGGGGGAGTGG + Intronic
1122746519 14:103900105-103900127 TGGGGGGTGCGGAGGAGAGCAGG + Intergenic
1122916332 14:104860709-104860731 TGGGGGGTGGAGATGGAGGGTGG - Intergenic
1122973025 14:105159901-105159923 TGGGGGGTGTGGATGGAACTCGG - Intronic
1123123089 14:105927077-105927099 TGGGGGCTGTAGGAGGAGGCAGG + Intronic
1124960476 15:34389692-34389714 TGTGGGGTGGGGAGGGAGGCGGG + Exonic
1124977105 15:34535913-34535935 TGTGGGGTGGGGAGGGAGGCGGG + Exonic
1125013359 15:34905096-34905118 TGGGGGGGGTGGGGGGAAGGGGG + Intronic
1125055968 15:35359228-35359250 TGGGGGGTGTTGAGGGGACATGG - Intronic
1125079712 15:35657986-35658008 GGGTGGGTGGAGAGGGATGCAGG - Intergenic
1125674721 15:41495839-41495861 TGCGGGCGGAAGAGGGAAGCGGG - Intronic
1126613836 15:50556285-50556307 TGGGAGGTGAAGGCGGAAGCAGG + Intronic
1126617726 15:50602783-50602805 AAGGGGATGTAAAGGGAAGCTGG + Intronic
1127559131 15:60118384-60118406 TGGGGAGTGGTGAGGGAAGGAGG + Intergenic
1128091502 15:64922103-64922125 TGGGGGCTGGAGGGGCAAGCAGG - Intronic
1129020573 15:72513858-72513880 GGCGGGGGGTAGAGGGAAGGAGG - Intronic
1129108440 15:73324036-73324058 TGGGGGGTGTTGGGGGAGGAGGG - Intronic
1129234269 15:74214349-74214371 TGGGGTGAGTGGAGGGAGGCAGG - Intergenic
1129393559 15:75232605-75232627 TGGGTGGGGCAGAGGGAAGGCGG + Intergenic
1129907390 15:79198084-79198106 TGCAGGCTGCAGAGGGAAGCAGG - Intergenic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130925617 15:88383600-88383622 TAGGTGGTGGAGAGGGAGGCTGG - Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131160006 15:90099471-90099493 TGGGGGGAGAAGGGGGAGGCAGG + Intronic
1132029781 15:98430255-98430277 TGGGGGGTGTGGAGTGTAGATGG - Intergenic
1132075373 15:98815583-98815605 TGGGGGGTGATGAGGGAGGGAGG + Intronic
1132184350 15:99791139-99791161 TGCGGGGTGGGGAGGGAGGCGGG - Intergenic
1132372226 15:101307008-101307030 TGAGAGGCCTAGAGGGAAGCTGG + Intronic
1132454779 16:16462-16484 TGTGGGGTGTCTAGGGAAGAAGG + Intronic
1132593015 16:734625-734647 TGGGGGGTGGAGACGCAAGCAGG - Intronic
1132870105 16:2112151-2112173 GGGGGAGTGGACAGGGAAGCTGG - Intronic
1132880883 16:2161214-2161236 GGGAGGGGGCAGAGGGAAGCAGG - Intronic
1133026035 16:2989378-2989400 TGTGGGGTTCAGGGGGAAGCAGG - Intergenic
1133497553 16:6333987-6334009 TGGTGGGGGTAGGGGGGAGCAGG + Intronic
1133696910 16:8273385-8273407 TGGAGGGTGGAGGGGGAAGTGGG - Intergenic
1133767670 16:8849135-8849157 TGGGAGGTTTGGAGGGAACCAGG - Exonic
1134231736 16:12435193-12435215 TGGGAGGAATAGAGGGAAACGGG - Intronic
1134717322 16:16363456-16363478 GGGGGAGTGGACAGGGAAGCTGG + Intergenic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1134957430 16:18388703-18388725 GGGGGAGTGGACAGGGAAGCTGG - Intergenic
1135475909 16:22774660-22774682 TGGGGGCTGTAAAGGGGACCTGG + Intergenic
1136063496 16:27743002-27743024 TGGGGGGTGTAGTGGGAGGAGGG - Intronic
1136237730 16:28925008-28925030 TGGGGGGTGGAGAGGGATGATGG - Intronic
1136394470 16:29985633-29985655 GGGCGAGTGCAGAGGGAAGCAGG - Intronic
1136683494 16:31981282-31981304 TGGGGTCTGGAGAGGGAAGGAGG + Intergenic
1136784124 16:32924842-32924864 TGGGGTCTGGAGAGGGAAGGAGG + Intergenic
1136885658 16:33928964-33928986 TGGGGTCTGGAGAGGGAAGGAGG - Intergenic
1137553002 16:49453232-49453254 TGGGGCTTGTGAAGGGAAGCCGG - Intergenic
1138251715 16:55506848-55506870 TGGGGGTGGTGGAGGGTAGCAGG - Intergenic
1139361423 16:66402421-66402443 TGTGGGGTGTAGGGGGATGGCGG + Intronic
1140430686 16:74900237-74900259 TGGGGGGTGATGAGGGAATTGGG + Intronic
1140546708 16:75816762-75816784 TGAGGGGTGGAGAGAGAAGCAGG + Intergenic
1142299177 16:89246930-89246952 AGGCGGGTGGAGAGAGAAGCCGG + Intergenic
1203086779 16_KI270728v1_random:1188844-1188866 TGGGGTCTGGAGAGGGAAGGAGG + Intergenic
1143283829 17:5774583-5774605 TGGGGGGTGGAGGTGGAGGCTGG - Intronic
1143283838 17:5774603-5774625 TGGGGGGTGGAGGTGGAGGCTGG - Intronic
1143283847 17:5774623-5774645 TGGGGGGTGGAGGTGGAGGCTGG - Intronic
1143283864 17:5774662-5774684 TGGGGGGTGGAGGTGGAGGCTGG - Intronic
1143420357 17:6786357-6786379 TAGGGGGTGCAGAGGGAAGTGGG + Intronic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1144634703 17:16897673-16897695 TGTGGGGAGTAAGGGGAAGCTGG + Intergenic
1144997671 17:19281734-19281756 TGGGGGGTGGACAGCCAAGCAGG + Intronic
1145056042 17:19704696-19704718 TGTGGGGAGTAGAGGGGAGGTGG + Intronic
1145168784 17:20637104-20637126 TGTGGGGAGTAAGGGGAAGCTGG + Intergenic
1145200721 17:20942189-20942211 TGTGGGGAGTAAGGGGAAGCTGG + Intergenic
1146164700 17:30578509-30578531 TGTGGGGAGTAAGGGGAAGCTGG + Intergenic
1146208924 17:30926881-30926903 TGGGGGATGTAGTAGAAAGCTGG - Exonic
1146456222 17:33011915-33011937 TGGGGACTGTAGAAGGCAGCTGG - Intergenic
1146655718 17:34633622-34633644 GCGGGGCTGGAGAGGGAAGCAGG + Intronic
1146976016 17:37112684-37112706 TGGGGGGACAAGAGAGAAGCGGG + Intronic
1147330532 17:39696445-39696467 GGGGGGGTGGAGAGTGAAGGGGG + Intronic
1148111581 17:45147521-45147543 GGGGGAGTGGAGGGGGAAGCGGG - Intergenic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148130154 17:45257431-45257453 TGGGGGATGGAGATGGAACCGGG - Intronic
1148213370 17:45821215-45821237 TGGGGGTTGTGTAGTGAAGCTGG - Intronic
1149017912 17:51930417-51930439 TGGGGGGAGGAGAGTGAAGGAGG + Intronic
1150210814 17:63440543-63440565 TGGGGGCTGCAGATGGAAACGGG - Intronic
1150486480 17:65547198-65547220 TGGGAGGGGTAGAAGGGAGCAGG - Intronic
1151145232 17:72034398-72034420 TGGGGAGAGGAGGGGGAAGCAGG - Intergenic
1151327813 17:73389713-73389735 TGGGGAGGGGAGAGGGAAGATGG + Intronic
1151448278 17:74181482-74181504 TGGGGTGGGGAGTGGGAAGCAGG - Intergenic
1151576212 17:74953745-74953767 TGGAGGTTCCAGAGGGAAGCAGG - Intronic
1151779691 17:76236958-76236980 TGGGAGGTTTAGAGGGAGGAAGG + Intronic
1151797041 17:76353444-76353466 TGGGGCGGGTGGAGGGGAGCGGG + Intronic
1151888003 17:76934504-76934526 TGGGGTGTGGAGCGGGGAGCTGG + Intronic
1151975011 17:77479755-77479777 TGGGGAGGGTTGAGGGATGCTGG + Intronic
1152038665 17:77889321-77889343 TGGGGTTTGTATAGGGAGGCAGG - Intergenic
1152130381 17:78472631-78472653 TGGGGTGTGGGGAGGGGAGCTGG + Intronic
1152161121 17:78669367-78669389 TGGGGGCTGGAGAGGGACTCTGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152610742 17:81314057-81314079 TGGGATGGGTGGAGGGAAGCTGG - Intronic
1152708100 17:81855790-81855812 TGGGGAGTGGAGAGGGAAGAGGG + Intronic
1153682597 18:7514632-7514654 TAGGAGGTGTCGAAGGAAGCAGG + Intergenic
1153993790 18:10422706-10422728 AGGGATGTGTTGAGGGAAGCTGG - Intergenic
1155621546 18:27785785-27785807 TGGGCGGGGTAGAGGAGAGCAGG - Intergenic
1156578560 18:38348987-38349009 TGGGGGGTCTAGATGGGAGATGG - Intergenic
1156695952 18:39768028-39768050 TGTGGGGTATAGATTGAAGCAGG - Intergenic
1157307640 18:46528773-46528795 TGTGGGGTGGAGAGGGGATCTGG - Intronic
1157793212 18:50551470-50551492 TGGGGGTGGGAGAGGGAAGTGGG - Intergenic
1158643039 18:59219768-59219790 TGGGGGGTGTAGCTGGAGACGGG - Intergenic
1159273166 18:66180269-66180291 TGGGGAGGGTAGGGGGAAGGAGG - Intergenic
1160229231 18:77033967-77033989 TGAGGGGTGCAGTGGGGAGCGGG - Intronic
1160771901 19:835730-835752 TGGGGGGTGTGGAAGGCGGCCGG + Intergenic
1160787448 19:907623-907645 TGAGGGGTGGTGAGGGAAGCAGG - Intronic
1161151312 19:2711526-2711548 TGGAGGGAGGAGAGGGAAGGTGG - Intergenic
1161175800 19:2841645-2841667 TGGGGGGAGCTGAGGGACGCGGG + Intronic
1161208904 19:3056256-3056278 TGGGGGGAGGAGGGGGAAGGAGG + Intronic
1161392492 19:4028638-4028660 TGGGGGGCGTGGAGGGAGGGTGG + Intronic
1161499622 19:4606862-4606884 TGGGGGGAGGAGAGGGGAGTGGG - Intergenic
1161654281 19:5504267-5504289 TGGGGGGTGAAGTCGGGAGCTGG - Intergenic
1161802908 19:6425713-6425735 TGGGGGGTCGAGAGAGAAGAAGG - Intergenic
1161853555 19:6751327-6751349 TTGGGGGTGGAGGGGGCAGCAGG - Exonic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1161956248 19:7497075-7497097 TGGGGTGTGTAGAAGGTAGAGGG + Intronic
1162052025 19:8040197-8040219 TGTGGGGTGTAGGGGGAAGTGGG + Intronic
1162532011 19:11241593-11241615 TGGGGGGCGCACAGGGCAGCTGG + Intronic
1162578527 19:11513591-11513613 TGGGGGGAGGAGAGGGAGGGAGG + Intronic
1162761516 19:12891408-12891430 TCGGGAGTGTGGAGGGAAGGAGG + Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1163026311 19:14514705-14514727 TTGGGGGTGGAGTGGGGAGCTGG - Intergenic
1163241348 19:16065767-16065789 GGGAGGGGGCAGAGGGAAGCTGG + Intergenic
1163250286 19:16122714-16122736 TGGAGGGTGGAGATGGAAGGAGG + Intronic
1164151799 19:22560272-22560294 TGGGAGGGGTAAAGGGAAGGAGG - Intergenic
1164612616 19:29643083-29643105 TGGGGGGTGCAGGGGGGAACAGG + Intergenic
1164714205 19:30379638-30379660 TGGGGGGTGTAGTGGGTATGCGG + Intronic
1165173302 19:33908098-33908120 TGGAGGGTGGACAGGGATGCTGG + Intergenic
1165828756 19:38720157-38720179 TGAGGGGTGTGGAGTGAAGGTGG - Intronic
1165895037 19:39136368-39136390 TGGCAGGAGAAGAGGGAAGCAGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166108772 19:40610447-40610469 AGGCAGGGGTAGAGGGAAGCGGG - Intronic
1166228870 19:41414026-41414048 CTGGGGGTGTAGAGGGGACCGGG - Intronic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1167148521 19:47696125-47696147 TGGGCGGTGATGTGGGAAGCAGG + Intronic
1167295235 19:48645729-48645751 TGTGGGGAGGAGAGGAAAGCTGG - Exonic
1167363348 19:49042112-49042134 AGGGGGATGTAGAGGGAGTCTGG - Intergenic
1168152004 19:54454413-54454435 TGGGGGCTGCAGAAGGAAGCAGG - Exonic
1168333127 19:55580881-55580903 TGGGGGGTGGAGGAGGAGGCTGG + Intergenic
924964579 2:63579-63601 AGGGGTGTGTGGATGGAAGCAGG - Intergenic
926301164 2:11603960-11603982 TGGGGGGTTTATAGTGAAACTGG + Intronic
929620742 2:43351482-43351504 TGGGGGTAGTTGAGGAAAGCTGG - Intronic
929863655 2:45699933-45699955 TGAGGGGTGCAGGGGGTAGCAGG + Intronic
929953039 2:46431450-46431472 TGGGGAGAGTAAAGGGAATCAGG + Intronic
930430949 2:51275313-51275335 TGGATGGGGTAGAGGGAAACAGG + Intergenic
930641365 2:53857443-53857465 AGAGGGGTGAAGAGGGATGCAGG + Intronic
931228885 2:60357223-60357245 TGAGGGGTGCAGAGGGGAGTGGG - Intergenic
932330477 2:70895862-70895884 AGGGGGCTGGAGAAGGAAGCAGG + Intergenic
932416905 2:71579076-71579098 TGTGGGGTGGAGAGGGAGGCTGG - Intronic
933372940 2:81440397-81440419 TGGGGGGAGTAGTGGGAAGCAGG + Intergenic
933657933 2:84905056-84905078 GGGGGGGTGTAGGGGGAGGGGGG - Intronic
934649495 2:96082897-96082919 TGGGAGGTGGAGAGGAGAGCTGG - Intergenic
935868594 2:107419671-107419693 TGGGATGTTTAGAAGGAAGCAGG - Intergenic
936024762 2:109022604-109022626 TGGGAGGGGGAGAGGGAAGAGGG + Intergenic
936462889 2:112725054-112725076 TGGGGGGTGTGGGAGGAAGGAGG - Intronic
936519858 2:113204865-113204887 TGAGGGGGGCAGAGGGAAACAGG + Intronic
936568331 2:113596635-113596657 TGTGGGGTGTCTAGGGAAGAAGG - Intergenic
936951210 2:117979346-117979368 TGGAGGGTGAGTAGGGAAGCAGG - Intronic
937106732 2:119322850-119322872 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
937127688 2:119484775-119484797 TGGGGGATGAAGAGGTATGCTGG + Intronic
937308849 2:120888977-120888999 TGGGGAGGGTAGAGTGAAGGAGG + Intronic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
937584482 2:123530044-123530066 TGGGGGAGGGAGAGGGGAGCTGG - Intergenic
937777000 2:125789770-125789792 TGGGGTGGGGTGAGGGAAGCTGG - Intergenic
937795176 2:126009010-126009032 TGGAGGGGGTAGGGGGAAGCTGG + Intergenic
938086623 2:128406134-128406156 TGGAGGGAGTAGAGGGGAGGAGG + Intergenic
939108485 2:137977911-137977933 TGGGGGGTGGGGAGGCAAGGTGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939411739 2:141835494-141835516 TGGGGGGAGGGGAGGGAAGGTGG + Intronic
939448304 2:142337888-142337910 TGGGAGATGAAGAGGGAAGCAGG - Intergenic
939510769 2:143101606-143101628 TGGCGGGAGGAGAAGGAAGCAGG + Intronic
940174029 2:150859394-150859416 TGGGGTCAGTAGAGTGAAGCTGG - Intergenic
940219906 2:151341081-151341103 TGGGGGGAAGAGTGGGAAGCGGG - Intergenic
940239014 2:151542912-151542934 TGGAGGGTGTGGAAGGATGCTGG - Intronic
941846017 2:170133903-170133925 TGGGGGGTGGTGGGGGGAGCAGG + Intergenic
942203348 2:173593884-173593906 TGGAGGGTTTAGAAGGAAACAGG - Intergenic
943727341 2:191265966-191265988 GAGGGGGTGGAGAGGGAGGCAGG + Intronic
943743203 2:191433648-191433670 TGGGGAGAGTAGAGGGGAGTGGG - Intergenic
944306869 2:198188867-198188889 AGGGGGGTGGAGTGGGAAGATGG - Intronic
945287797 2:208099598-208099620 TGGGGGATGAGGAGGGAAGTGGG - Intergenic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946182957 2:217959975-217959997 AGGAGGGTGGAGAAGGAAGCCGG + Intronic
946310531 2:218880491-218880513 TGGGGGGAGGAAAGGGAAGGCGG + Exonic
946880783 2:224175488-224175510 TGGGGGCTGTAGTGGCAAACAGG + Intergenic
947723620 2:232383278-232383300 TGGGGGTGGTAGAGGGTAGCAGG + Intergenic
947774509 2:232697233-232697255 TGGAGAGTGGGGAGGGAAGCGGG + Intergenic
947820034 2:233063122-233063144 TGAGGGGTGTGCAGGGCAGCCGG + Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948545820 2:238727981-238728003 TGGGGGTCACAGAGGGAAGCTGG + Intergenic
948567759 2:238897432-238897454 TGGGTGCTGTAGGGGGAAGGTGG - Intronic
1170417386 20:16159046-16159068 TGGGGGTTGTGGGAGGAAGCAGG - Intergenic
1171346752 20:24470957-24470979 TTGGGGGTGTCGAGGGGAGGGGG + Intronic
1172118282 20:32584085-32584107 TGGGGGGGGGGGAGGGAGGCAGG - Intronic
1172461540 20:35122781-35122803 TAGGAGGTGTAGAGGGGACCAGG - Intronic
1172789211 20:37490953-37490975 TGGAGAGTGTAGAGGGAAGATGG - Intergenic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173336839 20:42118898-42118920 TGGGGGGTGGAGAGAGCTGCAGG + Intronic
1173721032 20:45258374-45258396 TGGGAAGTGCAGAGGCAAGCAGG - Intergenic
1173747952 20:45452477-45452499 TGGGTGGAGCAGAGGGAAGCAGG - Intergenic
1173850848 20:46216730-46216752 TGGGAAGTCTAAAGGGAAGCTGG + Intronic
1174295644 20:49543327-49543349 GGAGGGGTGGAGAGGGAGGCAGG - Intronic
1175482394 20:59320822-59320844 TGGGGGTTGTGGAGGGCAGGGGG + Intronic
1175505963 20:59484332-59484354 TGTGGGGTGAAGCTGGAAGCTGG + Intergenic
1175975148 20:62707374-62707396 CGCAGGGTGTTGAGGGAAGCGGG - Intergenic
1175996891 20:62816102-62816124 TGGGGGTTGTAGGGGGCTGCAGG - Intergenic
1176039154 20:63055238-63055260 TGGGGGGTGTGGAGTGAGGCTGG + Intergenic
1176142071 20:63549188-63549210 TGGGGGGAGGAGAGGGCGGCGGG - Intronic
1177070867 21:16505902-16505924 TGGAGGGTGGAGAGAGAATCTGG + Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1177515549 21:22147170-22147192 TGGAGGGTGAAGTGGGGAGCTGG - Intergenic
1177853561 21:26377076-26377098 TGGGGAGGGTATAGGGAAGAGGG + Intergenic
1178595667 21:33950294-33950316 TAGGAGGTGGAGAGGGAAACAGG + Intergenic
1179042328 21:37815112-37815134 TGGGGAGGGTAGTGGGAGGCTGG + Intronic
1179363140 21:40731713-40731735 GGGGGGGTGCAGTGGGAAGGAGG - Intronic
1179819911 21:43930692-43930714 TGAGGGGAGCAGAGGGAAGCAGG + Intronic
1180084841 21:45503939-45503961 TGGGGGCTGCAGAGGGAACCCGG + Intronic
1181171119 22:21010803-21010825 TGTGGGGTGGAGAGGGCAGAGGG - Intronic
1181178226 22:21049716-21049738 TGTGGGGTGGAGAGGGCAGAGGG + Intronic
1181731653 22:24851395-24851417 TGGGGGCTGGAGAGGCATGCTGG - Intronic
1181758732 22:25043108-25043130 TGGGGGGTGGGGAGGAAAGGAGG + Intronic
1181904605 22:26184347-26184369 AGTGGGGTGGAGAGGGAGGCAGG - Intronic
1182086555 22:27565108-27565130 TGGGGGGTGGAGAGAGTGGCTGG - Intergenic
1182349519 22:29691398-29691420 TGGGCAGTGTAGAGGGACCCAGG + Intronic
1182361326 22:29748113-29748135 TGGAGGGTGTGAAGAGAAGCAGG - Intronic
1182529811 22:30946604-30946626 TGGGGGATGGAGAGGGAACGAGG - Intronic
1183086311 22:35489391-35489413 TGGAGGGTGGAGATGGAGGCAGG - Intergenic
1183250757 22:36728832-36728854 AGAGAGGTGTTGAGGGAAGCAGG - Intergenic
1183315343 22:37133937-37133959 TGGGGGGTGTGGAGGGGATGGGG - Intronic
1183459612 22:37941918-37941940 AGAGGTGTGTAGAGGGAAGGGGG - Exonic
1183743727 22:39681729-39681751 TGGGGGGTGTAAGGGACAGCTGG + Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184039378 22:41934014-41934036 TGGGGCTTGGAGAGGGAAGTGGG + Intergenic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
1184248696 22:43248457-43248479 TGGGGCTTGTAGGGGGAAGTAGG - Intronic
1184595565 22:45512040-45512062 TGGGGGATCAAGAGAGAAGCAGG - Intronic
1184694866 22:46133592-46133614 TGTGGGGTGAAGAGGCCAGCAGG - Intergenic
1184986943 22:48142213-48142235 TGGGGTCTGTCGAGGGCAGCTGG + Intergenic
1185025528 22:48408196-48408218 GTGGGGGTGTAGAGAGAAGCAGG - Intergenic
1185074418 22:48675671-48675693 TGGAGACTGCAGAGGGAAGCCGG - Intronic
1185100951 22:48840586-48840608 AGTGGGGTGTAGAGGGAGGAGGG - Intronic
949125259 3:439456-439478 TGGAGGGTGCAGAGGGAGGAGGG + Intergenic
949533115 3:4977005-4977027 TGGGGGGTGTCGGCGGAAGGGGG + Intergenic
949836157 3:8272451-8272473 TGGGGGGAGATGAGGGGAGCAGG + Intergenic
949863837 3:8530910-8530932 TGTGGAGTGTGGAGGGAAGCAGG - Intronic
949942407 3:9165040-9165062 TGGGGGATGCAGAGGCAGGCTGG + Intronic
950287460 3:11755987-11756009 CAGGGAGTGTAGAGGAAAGCTGG - Intergenic
950520153 3:13493308-13493330 TGAGGGGAGGAGAGGGAAGAGGG - Intronic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
951229082 3:20155844-20155866 TGGAGGGTGGACAGGGAAGGTGG + Intergenic
952298303 3:32081165-32081187 GGGGTGGTGTAGAGGGAAACAGG - Intergenic
952738830 3:36716400-36716422 TGGGTGGTGTAGGAGGAATCTGG - Intronic
952977794 3:38710634-38710656 TGGGGAGTGTAGATGAAAGGGGG + Intronic
953019584 3:39105003-39105025 TGGGGAGTGGGGAGGGAAGTAGG - Intronic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
954974096 3:54676521-54676543 TGGGCTGTGTAGAGGGCAGAAGG + Intronic
955347735 3:58173381-58173403 TTGGGGGTGGAGAGAAAAGCAGG + Intergenic
956086405 3:65615643-65615665 TGGAAGGTGGTGAGGGAAGCGGG - Intronic
956705572 3:71996176-71996198 TGGGGGTGGGAGAGGGAAGGAGG - Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
957004401 3:74927435-74927457 TGGGAGGGGTAGGGGGAAGAGGG + Intergenic
959644042 3:108677562-108677584 TGGGTGGTGGAGGAGGAAGCTGG - Exonic
960034284 3:113086869-113086891 TGGGAGGGGTAGGGGGAAGGAGG + Intergenic
960444350 3:117729577-117729599 TGGGGGTTGTTGAGGGAAAAGGG - Intergenic
961094481 3:124142738-124142760 TGGGGGGTGGAGATGGAAAGAGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203460 3:133417397-133417419 TGGGGTGAGTAGAGGGGAGATGG - Intronic
962293259 3:134155139-134155161 GGTGGGGTGAAGAAGGAAGCGGG - Intronic
962575987 3:136755494-136755516 AGTGGGGAGTAGAGGGAAGGTGG - Intergenic
962714708 3:138115993-138116015 TGGGGGCTGCGGAGGGAAGGTGG - Intergenic
962754809 3:138459158-138459180 TGGGGGGTGGAAAAGGAAGGTGG - Intronic
963348359 3:144123397-144123419 TGGGAGGTGTGGAGGTTAGCTGG + Intergenic
963760389 3:149282271-149282293 TGGGGGATGTTTAAGGAAGCAGG - Intergenic
964753604 3:160074802-160074824 TGGGGGCAGTAGTGGGAGGCAGG + Intergenic
965641077 3:170829579-170829601 TGGGGGGTGTCTAGGGAAGGTGG - Intronic
966604589 3:181809694-181809716 TTGGGGGTTGAGGGGGAAGCAGG - Intergenic
967195914 3:187025547-187025569 TGGGGTGTGTAGTGGGGAGTGGG + Intronic
967228403 3:187314625-187314647 TGGGAGGTGCAGTGGGAAGATGG + Intergenic
968259762 3:197310982-197311004 TGGTGGCTGTAGAGGGAGCCTGG + Intergenic
969504338 4:7574878-7574900 TGGGCGGTGTAAAGAGGAGCTGG - Intronic
969822746 4:9732785-9732807 AGGGGGATGGAGAGGGAAGGTGG + Intergenic
970831273 4:20343193-20343215 TGGGGGATGAAGAGAGAGGCTGG - Intronic
971025132 4:22582213-22582235 TGGGGGATGGAGTGGGAAGGTGG - Intergenic
971225352 4:24746673-24746695 TGGGGGGTGCATTGGGAAGGAGG + Intergenic
971588104 4:28431946-28431968 TGGGTGGTGTGGAGGGACTCTGG + Intergenic
972233036 4:37097444-37097466 TGGAGGGTGGAGAGGGGAGGAGG + Intergenic
972335674 4:38105586-38105608 TGGGGGGTGGAGAGGGAGGGAGG - Intronic
972525475 4:39906117-39906139 TGGGAGGTGGAGGTGGAAGCAGG + Intronic
973218710 4:47700805-47700827 TGGAGGGTGGAGGAGGAAGCAGG - Intronic
974200220 4:58627651-58627673 TGGGGGGTGGAGAGGGTGGGAGG + Intergenic
975252150 4:72192873-72192895 GGTGGGGTGGAGAGGGAAGAAGG + Intergenic
975355349 4:73396106-73396128 TGGGGGTTGTGGAGGGAAATTGG + Intergenic
978198777 4:106000564-106000586 TGTGGGGTGGAGCGGGTAGCAGG + Intronic
980096612 4:128497868-128497890 TGGGAAGTGTAGGGGGAAGTAGG - Intergenic
980874378 4:138646086-138646108 TGGGGGGAGCAGTGGGTAGCTGG - Intergenic
982465191 4:155721882-155721904 TGTGAGGAGTAGAGGGAAGTTGG + Intronic
983093968 4:163540401-163540423 TTGGGGTTGCAGAGGGGAGCGGG + Intronic
983144467 4:164196810-164196832 TGGGGGTTGTGGAGGGAGGGAGG - Intronic
985645674 5:1083694-1083716 TGGGGGGTGGCGGGGGCAGCAGG - Intronic
985771974 5:1817510-1817532 TGGGAGGGGGAGAGGGAAGAAGG + Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986034942 5:3928261-3928283 AGGGGTGTGTAGGGGGAGGCGGG - Intergenic
986135073 5:4969353-4969375 AGGGGGCTGCAGAGGGACGCAGG - Intergenic
986221878 5:5775622-5775644 TGTGAGGTGTGGAAGGAAGCAGG + Intergenic
986449228 5:7849946-7849968 TGGAGGGGGTCGCGGGAAGCCGG - Intronic
987125759 5:14810986-14811008 TGTGGGGTGAAGAAGGAAGGGGG + Intronic
987163041 5:15164905-15164927 TGGGGGATATAGAATGAAGCTGG - Intergenic
988740346 5:34063518-34063540 TGGGGGGGCTGGGGGGAAGCTGG + Intronic
990155486 5:52872546-52872568 AGGCGGGTGTAAGGGGAAGCAGG - Intronic
990208765 5:53458612-53458634 TGGGGGAAGGAGAGGGTAGCAGG + Intergenic
990237631 5:53784582-53784604 TGGGGGGTGTAGAAAGTTGCGGG + Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
993195779 5:84743606-84743628 TGGGGGCTGGGGAGGGAAGGAGG - Intergenic
995265039 5:110150073-110150095 TGGGAAGGGTAGAGGGAAGTGGG - Intergenic
995322627 5:110854162-110854184 TGTGGGGTGAAGAATGAAGCAGG + Intergenic
995615672 5:113960493-113960515 TGAGGGATTTAGAGGGAAGGGGG + Intergenic
997235858 5:132271625-132271647 CAGGGGGTGGAGAGGGAATCGGG - Intronic
997468247 5:134102321-134102343 TGGGGGGGGTAGAGGGTGGGGGG - Intergenic
997631164 5:135369847-135369869 TTGGGAGTGTTGGGGGAAGCAGG - Intronic
997905122 5:137808766-137808788 TGGTGGGTGTAGAGGTCAGTGGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998207052 5:140165449-140165471 TGGGGAGTGTACAGGGAAAGAGG + Intergenic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998618938 5:143773152-143773174 TGGAAGGTGAACAGGGAAGCAGG + Intergenic
998735569 5:145136089-145136111 TGGAGAGGGTAGAGGGAAGGAGG - Intergenic
999233795 5:150078526-150078548 TGGGGGGCTTGGAGGGAGGCAGG - Intronic
999282347 5:150374048-150374070 TGGGGAGTGGGGAGGGAAGCAGG + Intronic
1001195014 5:169664602-169664624 TGGAAGGTGAAGGGGGAAGCAGG + Intronic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1001489956 5:172148303-172148325 GGTGGGGGGCAGAGGGAAGCAGG + Intronic
1001523130 5:172409479-172409501 TGGGGAGGGTAGGGGGAAGTGGG - Intronic
1001588644 5:172850485-172850507 TCGGGGGAGTAGAGGGAGGTGGG + Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1002072932 5:176691185-176691207 TGGGGTGTGTCGTGGGAAGGAGG + Intergenic
1003893020 6:10580271-10580293 AGGGGGGTGGGGAGGGATGCAGG + Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004733287 6:18380108-18380130 TGGAGGGTATAGAGGGTGGCAGG + Intergenic
1005841606 6:29747904-29747926 TGGGTGGTCTAGAGGGGAGTGGG + Intergenic
1006376075 6:33672279-33672301 TGGGGCGGGTACAGGGAGGCTGG + Intronic
1006455633 6:34130317-34130339 TGGGGAGTGGAGAAGAAAGCAGG - Intronic
1006498248 6:34439829-34439851 GGGGGGGTGCAGGCGGAAGCAGG - Intergenic
1006613832 6:35311736-35311758 AGTGGGGAGTAGAGGTAAGCTGG - Intronic
1007368853 6:41413253-41413275 GGGGGAGTGGAGAGGGAAGGGGG - Intergenic
1007390168 6:41546310-41546332 AGGAGGGTGGAGAGGGAAGGAGG - Intergenic
1007395497 6:41575541-41575563 TAGGGGGTGTAGGGGGAGGAAGG + Intronic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008370299 6:50723698-50723720 TGGGGGTTGTAGAGGGAAAGAGG + Intronic
1010313437 6:74416521-74416543 TGGGAAGGGTAGAGGGAAGGGGG - Intergenic
1010519029 6:76810145-76810167 TGGGGGATGGAGTGGGAAGGTGG - Intergenic
1011357984 6:86492260-86492282 TGGGGTGGGGAGAGGGAAGAGGG - Intergenic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1013236729 6:108203304-108203326 TCGAGGGAGTAGAGGCAAGCAGG + Intergenic
1014097745 6:117479011-117479033 TCTGGGGGGTAGTGGGAAGCAGG - Intronic
1014175998 6:118331927-118331949 TGGGGACTGTAGAGAGAAGGAGG + Intergenic
1014802839 6:125796318-125796340 TGGGGGGTGGGGAGAGAAGAAGG - Intronic
1014934282 6:127368209-127368231 TGGGGAGAGTAGAGGTAAGGGGG - Intergenic
1015450374 6:133360734-133360756 AGGAAGGTGTAGAGGAAAGCTGG - Intronic
1015704641 6:136074568-136074590 TGGGAAGTGTAGTGGGAAGGAGG - Intronic
1016910359 6:149192736-149192758 TGAGGGAGGGAGAGGGAAGCAGG - Intergenic
1018526037 6:164710653-164710675 TGGGGGATGGAGTGGGAAGGTGG + Intergenic
1018674496 6:166207146-166207168 TGGTGGGTCTTCAGGGAAGCCGG - Intergenic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019019781 6:168908674-168908696 TGGAGGTTGTGGAGGCAAGCAGG + Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019079158 6:169417828-169417850 TGGGGTGTGGTGAGGGAAGAGGG - Intergenic
1019571576 7:1715344-1715366 TGTGGGGTGGAGGCGGAAGCAGG - Intronic
1019619941 7:1987050-1987072 CGGGGGGTGTAGGTGGAAGGTGG - Intronic
1019665488 7:2250110-2250132 TGTGGGGTGGAGGGGGACGCAGG - Intronic
1019882760 7:3877426-3877448 TGTGGGGTGGAGAGGGAACACGG - Intronic
1021336884 7:19414369-19414391 TGGGTGGGGTAGAGGGGAGGAGG - Intergenic
1021355016 7:19643558-19643580 GGGGTAGTGTAAAGGGAAGCGGG + Intergenic
1022383902 7:29884466-29884488 TGGGGGATTTAGGGGGTAGCGGG - Exonic
1022962209 7:35438181-35438203 TGGAGGGTGCAGAGGGCTGCTGG + Intergenic
1023040952 7:36172894-36172916 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
1023625194 7:42108588-42108610 TGGGCACTGTAGAGGGAGGCAGG - Intronic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1024755109 7:52519832-52519854 TGGAAGGTGAAGGGGGAAGCAGG + Intergenic
1025694403 7:63767485-63767507 TTGGGAGTGCAGAGGGAATCGGG + Intergenic
1026323602 7:69288621-69288643 TTTGGGGTGGAGAGGGAAGTGGG - Intergenic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1027189528 7:75988981-75989003 TGGGGGGTGGAGGGGAAGGCCGG + Intronic
1027189544 7:75989010-75989032 TGGGGGGTGGAGGGGAAGGCCGG + Intronic
1027189557 7:75989035-75989057 TGGGGGGTGGAGGGGAAGGCCGG + Intronic
1027241936 7:76336347-76336369 TGGGGGCTGCTGAGGGAAGAAGG + Intronic
1027443895 7:78249698-78249720 TGGGGAGGGTAGTGGGAAGGAGG + Intronic
1028439825 7:90846940-90846962 TGTGTGGAGTAGAGGCAAGCAGG + Intronic
1028668523 7:93373739-93373761 TGGGGACTGTAGTGGGAAGGAGG + Intergenic
1029747082 7:102521982-102522004 TTGGTGGGGTAGGGGGAAGCTGG - Intergenic
1029765035 7:102621071-102621093 TTGGTGGGGTAGGGGGAAGCTGG - Intronic
1030109412 7:106013690-106013712 TGGGAGGTGGAGAAGAAAGCTGG - Intronic
1031692909 7:124812930-124812952 TGGGGGGTGGGGAGGGATGCAGG - Intergenic
1032021179 7:128407914-128407936 TGGGAGGTGTGTAGGGGAGCAGG - Intronic
1033291693 7:140090371-140090393 TGGGGAGTGCAGAGGGAAGGTGG + Exonic
1033527686 7:142232608-142232630 GGGGGGATGGAGAGGGAAGGTGG + Intergenic
1033970623 7:147034704-147034726 AGGGGGATGGAGTGGGAAGCTGG + Intronic
1034405423 7:150899555-150899577 GGGGCTGTGTGGAGGGAAGCAGG - Intergenic
1034447604 7:151121556-151121578 TGGGCGGAGGAGAGGGTAGCAGG - Intronic
1034687229 7:152983354-152983376 TGGGGAGGGTAGGGGGAAGTGGG + Intergenic
1035908647 8:3541364-3541386 TGGGGCCTGTTGAGGGGAGCTGG + Intronic
1036127892 8:6080270-6080292 TGGGAAGTGTAGTGGGAAGTTGG - Intergenic
1036447840 8:8838473-8838495 TGTGGGGTATAGGGGGAAGAAGG - Intronic
1036633043 8:10528957-10528979 TGAGAGGGGTGGAGGGAAGCAGG - Intronic
1037219816 8:16504886-16504908 TGTGGGGTGGAGTGGGAAGTGGG - Intronic
1037226549 8:16599135-16599157 TGGGGTGTGAAGTGGGAAGAAGG - Intergenic
1037936172 8:22916475-22916497 TGGGGGGTGGGTGGGGAAGCAGG - Intronic
1038153959 8:24969844-24969866 TGGGAAGGGTAGAGGGAAGGAGG - Intergenic
1038476512 8:27872190-27872212 GGGGGCGTGGAGAGGGCAGCTGG - Intronic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1041642475 8:60218031-60218053 AGGGGGTTGGAGAGGGAAGCAGG - Intronic
1042784938 8:72536851-72536873 TGGGAGCTGCAGAGCGAAGCAGG + Intergenic
1043148260 8:76682224-76682246 TGGGGGGTGGAGGGTAAAGCAGG - Intronic
1043393000 8:79809340-79809362 TGGGGGGTGGAGAAGGCAGCTGG + Intergenic
1044945545 8:97385605-97385627 TGGATGGTGAAAAGGGAAGCAGG + Intergenic
1044994991 8:97830237-97830259 AGGGAGGGGTAGAGGGTAGCAGG + Intronic
1045388271 8:101691228-101691250 TGGGAGCTGTAGAAGGAAGGAGG - Intronic
1045445354 8:102256762-102256784 TGGGGGTGGTGGAGGGAAGGAGG - Intronic
1045948409 8:107824242-107824264 TGGGGCCTGTAGAGGGGAGAGGG - Intergenic
1045962880 8:107989379-107989401 TGGAGGAGGTAGAGGGAAGAAGG - Intronic
1046801761 8:118436383-118436405 AGGTTGGTGTAGAGGGCAGCAGG + Intronic
1048036347 8:130681024-130681046 TGTGTGGTGCAGTGGGAAGCAGG - Intergenic
1048048952 8:130799127-130799149 TGGGGGGTGGGGTGGGAAGAGGG + Intronic
1048917955 8:139202457-139202479 TGGAAGGTGAAGGGGGAAGCAGG + Intergenic
1049032961 8:140050708-140050730 TGGGGGCTGGGGAGGGAAGAAGG + Intronic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1049760728 8:144330953-144330975 GGCGGGGTGTAGGGGGAAGCAGG + Exonic
1049780228 8:144425503-144425525 TGGGGGCTGGTGAGGGAGGCGGG - Intronic
1049884199 9:16890-16912 TGTGGGGTGTCTAGGGAAGAAGG + Intergenic
1050113461 9:2240367-2240389 TGGGTGGGGTGGTGGGAAGCAGG + Intergenic
1050203700 9:3175982-3176004 TGGTGGGTTTTGAGTGAAGCAGG - Intergenic
1050255992 9:3792861-3792883 TGGGGGGAGTAGGGGGCAGGGGG - Intergenic
1052866697 9:33468425-33468447 TGGGGGGTGTAGAGAGAAGCAGG + Intronic
1052935513 9:34089689-34089711 TGGGGCGGGTGGAGGGGAGCAGG - Intronic
1053160373 9:35809918-35809940 TGAGGGGTGAGGAGGGAAGTGGG - Intronic
1053285416 9:36846937-36846959 TGGTGGGTGGAGAGAGAAACAGG + Intronic
1055538840 9:77279258-77279280 TGGGGGATGGAGTGGGAAGGTGG + Intronic
1055833138 9:80406532-80406554 AGGGGGCTGGAGAGGGAAGAAGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057689548 9:97271438-97271460 TGGGGGGTGGGGAGGGGAGCCGG - Intergenic
1057878367 9:98774591-98774613 TTGGGAGTGAAGAAGGAAGCAGG + Intronic
1058878405 9:109265083-109265105 TGGGGTTTGCAGTGGGAAGCTGG - Intronic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1060149594 9:121279743-121279765 TGGGGTGTGTAGAAAGAAGGGGG + Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060661456 9:125407660-125407682 TGGGGGGTTCAGAGGAGAGCTGG + Intergenic
1061053080 9:128207481-128207503 TGGGGGGTGTAGCGGGGCGGGGG - Intronic
1061298035 9:129687543-129687565 TTGAGTGTGCAGAGGGAAGCCGG - Intronic
1061679387 9:132235591-132235613 GGGGTGGTGCTGAGGGAAGCTGG - Intronic
1061957162 9:133969766-133969788 TGGGGGGTGGGGAGAGAAGTGGG - Intronic
1062517948 9:136945467-136945489 TGGGGGGGGTAGAGGGAGGCAGG + Intronic
1062517956 9:136945499-136945521 TGGGAGGGGTAGAGGGAGACAGG + Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1062544519 9:137055511-137055533 TGGGGTGTGTGGGGGGAAACTGG - Intergenic
1203774344 EBV:64436-64458 TGTGGGGCGCAGCGGGAAGCAGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186373505 X:8970993-8971015 TGGAAGGTGAAGGGGGAAGCTGG - Intergenic
1186502200 X:10060435-10060457 TGGGGGGTGCAGAGGGGCGGTGG + Intronic
1187815360 X:23225675-23225697 TGAGGGGTGGGGAGAGAAGCAGG - Intergenic
1189178692 X:38982855-38982877 TAGGGGGTGTGGATGGAAGGAGG + Intergenic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190475414 X:50822171-50822193 TGGGAAGGGTAGAGGGAAGGGGG + Intergenic
1192337653 X:70235475-70235497 TAGTGGCTGTACAGGGAAGCAGG + Intronic
1192533188 X:71907247-71907269 TGAGGGCTGTACTGGGAAGCTGG + Intergenic
1193138618 X:78001580-78001602 TGGGGGTTGTAAGGGGAAGTGGG - Intronic
1194478274 X:94388101-94388123 TGGGGGAAGTGGAGGGTAGCAGG + Intergenic
1195906356 X:109848511-109848533 TGGAGGGGGTGGAGGGGAGCAGG - Intergenic
1196008113 X:110856809-110856831 TGGGAGATGTAAAGGGAAGAAGG - Intergenic
1196289604 X:113923647-113923669 TGGGAGGTGTATTGGGAAGGGGG - Intergenic
1197753836 X:129981925-129981947 TGGGGGGGGGAGCGGGAAGAAGG + Intronic
1197813804 X:130476164-130476186 TGGAAGGTGAAGGGGGAAGCTGG + Intergenic
1198342769 X:135731418-135731440 GTGGGGGTGTCGGGGGAAGCGGG - Intergenic
1198345220 X:135751877-135751899 GTGGGGGTGTCGGGGGAAGCGGG + Intergenic
1198992041 X:142525852-142525874 AGGGGGGTGTAGGGGGAGGGAGG - Intergenic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1200234351 X:154461014-154461036 AGGGGGATGCAGAGGGAAGCTGG + Intronic
1200401604 X:156023266-156023288 TGCGGGGTGTCTAGGGAAGAAGG - Intergenic