ID: 1062518523

View in Genome Browser
Species Human (GRCh38)
Location 9:136947734-136947756
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062518511_1062518523 1 Left 1062518511 9:136947710-136947732 CCTTGGAGTTGGTCCCAAAGCAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr