ID: 1062519411

View in Genome Browser
Species Human (GRCh38)
Location 9:136951513-136951535
Sequence TGCCTATAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816713
Summary {0: 10529, 1: 112818, 2: 243046, 3: 240273, 4: 210047}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062519411_1062519417 20 Left 1062519411 9:136951513-136951535 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1062519417 9:136951556-136951578 ACTAATCCTTTCTTTTAGGCAGG No data
1062519411_1062519415 16 Left 1062519411 9:136951513-136951535 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1062519415 9:136951552-136951574 GCCTACTAATCCTTTCTTTTAGG No data
1062519411_1062519412 -6 Left 1062519411 9:136951513-136951535 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1062519412 9:136951530-136951552 TAGGCATGAGCCTCTGTGCCTGG 0: 10
1: 1156
2: 11671
3: 39809
4: 91422
1062519411_1062519419 30 Left 1062519411 9:136951513-136951535 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062519411 Original CRISPR TGCCTATAATCCCAGCACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr