ID: 1062519413

View in Genome Browser
Species Human (GRCh38)
Location 9:136951540-136951562
Sequence GATTAGTAGGCCAGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7000
Summary {0: 1, 1: 13, 2: 104, 3: 1082, 4: 5800}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062519413_1062519425 26 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519425 9:136951589-136951611 GGTGCCCACTCCCATTAGTGGGG No data
1062519413_1062519421 5 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519421 9:136951568-136951590 TTTTAGGCAGGACCAGCATGGGG No data
1062519413_1062519424 25 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519424 9:136951588-136951610 GGGTGCCCACTCCCATTAGTGGG No data
1062519413_1062519420 4 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519420 9:136951567-136951589 CTTTTAGGCAGGACCAGCATGGG No data
1062519413_1062519423 24 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519423 9:136951587-136951609 GGGGTGCCCACTCCCATTAGTGG No data
1062519413_1062519419 3 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data
1062519413_1062519417 -7 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519417 9:136951556-136951578 ACTAATCCTTTCTTTTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062519413 Original CRISPR GATTAGTAGGCCAGGCACAG AGG (reversed) Intronic
Too many off-targets to display for this crispr