ID: 1062519414

View in Genome Browser
Species Human (GRCh38)
Location 9:136951548-136951570
Sequence AAAGAAAGGATTAGTAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 666}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062519414_1062519423 16 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519423 9:136951587-136951609 GGGGTGCCCACTCCCATTAGTGG No data
1062519414_1062519420 -4 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519420 9:136951567-136951589 CTTTTAGGCAGGACCAGCATGGG No data
1062519414_1062519419 -5 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data
1062519414_1062519421 -3 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519421 9:136951568-136951590 TTTTAGGCAGGACCAGCATGGGG No data
1062519414_1062519424 17 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519424 9:136951588-136951610 GGGTGCCCACTCCCATTAGTGGG No data
1062519414_1062519425 18 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519425 9:136951589-136951611 GGTGCCCACTCCCATTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062519414 Original CRISPR AAAGAAAGGATTAGTAGGCC AGG (reversed) Intronic
900678302 1:3901868-3901890 AAAGAAAAGAACAGTGGGCCTGG - Intergenic
901122260 1:6905488-6905510 AAAGAAAGGAGGAGCAGGCCGGG - Intronic
901397562 1:8992481-8992503 AAAGAAAGAAAGAGCAGGCCAGG - Intergenic
901499803 1:9644991-9645013 AAAGAAAAGAAAAATAGGCCTGG - Intergenic
901820733 1:11827699-11827721 CAAGAAAGGATAACAAGGCCAGG - Intronic
902752416 1:18526303-18526325 AAAGTAAGGATTTGGAGGACAGG - Intergenic
902830763 1:19010775-19010797 AAAGAAAGGAGGAGTGGGCAGGG + Intergenic
903614026 1:24639017-24639039 AAAGAAAAGAAAAATAGGCCAGG + Intronic
903777584 1:25802649-25802671 CAAGAATGGAATAGGAGGCCGGG - Intronic
903930046 1:26856791-26856813 AGAGAGAGGGTTAGCAGGCCTGG - Exonic
903971272 1:27120419-27120441 AAAAAAAGTATTATTTGGCCAGG - Intronic
904158402 1:28503948-28503970 AAAAAAAAAATTTGTAGGCCGGG + Intergenic
904797582 1:33068962-33068984 AAAAAAAGGATTTATAGGTCGGG + Intronic
905020957 1:34811759-34811781 ACAAAAAGCATTGGTAGGCCAGG - Intronic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905538416 1:38741736-38741758 AAAAGAAGAAATAGTAGGCCGGG + Intergenic
905620213 1:39438785-39438807 AAAGAAATAAATAATAGGCCGGG + Intronic
905878111 1:41446315-41446337 TTAGAAAGGATAAGTAGGCCAGG + Intergenic
906221039 1:44079597-44079619 ATATAAAGAATTACTAGGCCAGG - Intergenic
906747676 1:48233065-48233087 AAAGAAAAGAAAAGAAGGCCAGG + Intronic
907066082 1:51484264-51484286 AAAGAAACTATTATTGGGCCAGG + Intronic
907208841 1:52800511-52800533 AAAGAAGGAATTAGTAGGCTGGG + Intronic
907296264 1:53457506-53457528 AAAAATATGATTAGTGGGCCGGG - Intergenic
907864015 1:58381320-58381342 AAAGATGGGAGAAGTAGGCCAGG + Intronic
908182616 1:61621259-61621281 AAAGAAAGGAATTGTAGGTAAGG + Intergenic
908414536 1:63900156-63900178 ATAGAAAGGAAAAGTTGGCCGGG + Intronic
908818600 1:68058820-68058842 AAAGAAAAGACAACTAGGCCCGG - Intergenic
909877287 1:80823869-80823891 AAAGAAAGGGATAGGCGGCCGGG + Intergenic
910298900 1:85683221-85683243 AAAGAAAAAATTGCTAGGCCAGG + Intronic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911037821 1:93568975-93568997 AAAGAAATGAGTAGCAGGCATGG - Intronic
911220027 1:95235652-95235674 AAAAAAAGTATCAGAAGGCCAGG - Intronic
911427082 1:97730517-97730539 TATTAAAGGATAAGTAGGCCAGG - Intronic
912547970 1:110465065-110465087 AAAGCAAGGACTAGCAAGCCCGG + Intergenic
912555361 1:110512245-110512267 AAATATAGAATTAATAGGCCGGG - Intergenic
913598654 1:120402819-120402841 TAAGAAACTATTATTAGGCCGGG + Intergenic
913679432 1:121174660-121174682 AAAAAAAGGAATAAGAGGCCGGG - Intronic
914031262 1:143962307-143962329 AAAAAAAGGAATAAGAGGCCGGG - Intronic
914088727 1:144476799-144476821 TAAGAAACTATTATTAGGCCGGG - Intergenic
914158185 1:145105655-145105677 AAAAAAAGGAATAAGAGGCCGGG + Intronic
914309886 1:146457403-146457425 TAAGAAACTATTATTAGGCCGGG + Intergenic
914592224 1:149115729-149115751 TAAGAAACTATTATTAGGCCGGG - Intergenic
914743144 1:150481818-150481840 AAAGAAAGGATTATGAGGCCGGG - Intergenic
914769128 1:150667887-150667909 AAAGAAAAGACTAGTGGGCCGGG - Intronic
915027837 1:152849637-152849659 AAAGAAAGAATGAGTGAGCCAGG + Intergenic
915035961 1:152925214-152925236 AAAGAAAGTATATGTAGGCCGGG - Intergenic
915154537 1:153863918-153863940 AAAAACAGGATTTTTAGGCCGGG - Intronic
915228359 1:154427860-154427882 CAAGAAGGGATTTGCAGGCCAGG + Intronic
915335598 1:155139351-155139373 AAAAAAAGAAGTAGTACGCCGGG + Intergenic
916927549 1:169539253-169539275 AAAGATGGGATTAGTAGGGGAGG - Intronic
917817066 1:178721953-178721975 AAAGATAGTTTTAGTAGGGCCGG - Intergenic
918414802 1:184295684-184295706 TAAGATAGGAATAATAGGCCAGG + Intergenic
919512962 1:198489508-198489530 AAAGAAAGTATTATTAGGCTGGG + Intergenic
920327625 1:205178837-205178859 AAAGATAGGAATTATAGGCCGGG + Intronic
920466733 1:206193206-206193228 AAAAAAAGGAATAAGAGGCCGGG - Intronic
921015826 1:211189846-211189868 AATGAAAGTAAGAGTAGGCCGGG - Intergenic
921489912 1:215762789-215762811 AAAGAAATGAATAGTAGGGAGGG + Intronic
921538907 1:216387942-216387964 AAAGAGAGGGTTAGAAGGTCAGG - Intronic
921835265 1:219771978-219772000 AAAAAGAGGATTGGGAGGCCGGG - Intronic
922450005 1:225729313-225729335 AAAAAAAAGATTAGGAGGCTGGG + Intergenic
923198033 1:231686561-231686583 AAAAAAAGGTTTTGTGGGCCGGG - Intronic
923539797 1:234879853-234879875 ACTGAAAGTATTTGTAGGCCCGG - Intergenic
924312976 1:242764884-242764906 AATTAAAGAAATAGTAGGCCAGG + Intergenic
924444010 1:244111660-244111682 AAAGAAAGGGTTGATAGGGCAGG - Intergenic
1063913164 10:10853274-10853296 AAAATAATGATTAATAGGCCGGG - Intergenic
1064051618 10:12064638-12064660 AAAGAAAAGATTGTGAGGCCCGG - Intergenic
1064142546 10:12802813-12802835 AAAGAAATGAAGAGCAGGCCGGG - Intronic
1064627311 10:17274271-17274293 AAAGAAAGAGATAATAGGCCAGG - Intergenic
1065764239 10:29011983-29012005 AAAGAAATGTTTAAGAGGCCAGG + Intergenic
1066040959 10:31547758-31547780 AAAGAATGGTTTTGTGGGCCAGG + Intergenic
1066395142 10:35013043-35013065 AAAGAAATGAGCTGTAGGCCAGG + Intronic
1067715562 10:48688076-48688098 AAAGAATGGCCTATTAGGCCGGG - Intronic
1067785648 10:49244006-49244028 AAAGCAAGGCTAAGTAGGACAGG + Intergenic
1068235762 10:54231157-54231179 AAAGAATGGTTTTGTGGGCCAGG + Intronic
1069294861 10:66830902-66830924 AAAGAAGAAATTAGTAGGCCAGG - Intronic
1069470751 10:68687196-68687218 TAAAAAAGGATAAGTAGGCCGGG - Intronic
1069974527 10:72201952-72201974 AAATAAAGGACTAAAAGGCCGGG + Intronic
1070079569 10:73171921-73171943 AATAAAAGGATAAGGAGGCCAGG - Intronic
1070115864 10:73528227-73528249 AAAGAATGTATTAGTGGGCCAGG - Intronic
1071042991 10:81336965-81336987 AAAGAATGGTTTTGTGGGCCAGG + Intergenic
1071071945 10:81704754-81704776 AAAGAATGGTTTTGTGGGCCAGG + Intergenic
1071511484 10:86265080-86265102 TCAGAAAGGATGAGTAGCCCAGG - Intronic
1071800929 10:89059037-89059059 AAAGAGAGGATGAGGGGGCCTGG + Intergenic
1072024778 10:91444120-91444142 TAAGAAAGGGTAAGTAAGCCTGG - Intronic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073434283 10:103506854-103506876 AAAGAAAGCAGAAGTGGGCCGGG - Intronic
1073497571 10:103907831-103907853 AAAAAAAAAATTAGCAGGCCAGG + Intronic
1073979840 10:109142334-109142356 GAAGAATGGTTTTGTAGGCCAGG + Intergenic
1074099945 10:110346952-110346974 AATGAAAGGATGGGTAGGCCAGG + Intergenic
1074955024 10:118380271-118380293 AAAGAAAGGATTTGGGGGCTGGG - Intergenic
1075053952 10:119204494-119204516 TAAGAAAGGTTTTATAGGCCGGG - Intergenic
1075770648 10:124931664-124931686 AAATAAAGTATTTTTAGGCCAGG - Intergenic
1075858721 10:125655147-125655169 AAAGAAAGCTGTAGAAGGCCAGG + Intronic
1076101704 10:127785593-127785615 AGAGAAAGGATTGACAGGCCAGG + Intergenic
1076204816 10:128588684-128588706 AAAGAAAGGATGAATAAGACAGG - Intergenic
1077575034 11:3376457-3376479 AAAGAAAGCAATCGAAGGCCTGG - Intronic
1077763640 11:5133072-5133094 AAAGAAAGGATCCACAGGCCGGG + Intergenic
1078192697 11:9104951-9104973 AAAGAAACGGCCAGTAGGCCGGG + Intronic
1078232897 11:9459173-9459195 AAAAAATGGATTAGGTGGCCGGG - Intergenic
1078485783 11:11722118-11722140 AAAAAAAGTATAAGTAGGCTGGG - Intergenic
1078598443 11:12710029-12710051 AAAAAATGGAATTGTAGGCCAGG + Intronic
1078721408 11:13887487-13887509 AAAGAAAAGATTAGTAGGTTGGG - Intergenic
1079134654 11:17769544-17769566 AAAGAAAGGAGGGATAGGCCAGG + Intronic
1079285470 11:19126643-19126665 AAAGAAAGGAACAGCAGGCTGGG - Intronic
1080477024 11:32605145-32605167 AAAAAAAGTATTACTAGGTCGGG - Exonic
1081206307 11:40279981-40280003 AAAGAAAGGGTGAGTAGTTCAGG - Intronic
1083085937 11:60145446-60145468 AAAGAAATAATTAGTAATCCTGG - Intergenic
1083402333 11:62432377-62432399 AAAGATGAGATTAGTTGGCCAGG + Intergenic
1083653539 11:64218297-64218319 AAAGAAAGAAAAAGAAGGCCAGG - Intronic
1084062127 11:66683047-66683069 AAAAAATGGATTACTTGGCCAGG - Intergenic
1084986327 11:72876022-72876044 AAAGAAATGACTAGTTGGCTTGG + Intronic
1085684865 11:78612299-78612321 AAAGCCAGGATTAATAGGTCTGG + Intergenic
1086090563 11:83000756-83000778 AAAAAAAGGCTTTGTCGGCCGGG + Intronic
1086206006 11:84258974-84258996 AAAGAATGCATGTGTAGGCCAGG + Intronic
1086672583 11:89566335-89566357 AAAGAAAGTATTAATAGGCTGGG - Intergenic
1087708371 11:101521196-101521218 GAAGAATGGTTTCGTAGGCCAGG + Intronic
1087908318 11:103724748-103724770 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
1088290594 11:108232842-108232864 AAAGAAATGAACAGTAGGCTGGG - Intronic
1089470505 11:118716587-118716609 AAAAAAGGGAGTAGAAGGCCGGG - Intergenic
1089538346 11:119174223-119174245 AAAGAAAGGAACAGAAGGCTGGG - Intronic
1090728705 11:129551295-129551317 AAAGAATGGATTCAGAGGCCGGG + Intergenic
1091492304 12:943642-943664 AAATAAAGAACTAATAGGCCAGG - Intronic
1091751851 12:3027259-3027281 AAAGAAAGGAGCAGGAGGCTGGG - Intronic
1092366915 12:7883876-7883898 TAAGAAAGCATTTGTGGGCCAGG - Intronic
1092393319 12:8101390-8101412 AAAGAAAGAAGTAACAGGCCAGG + Intergenic
1092836775 12:12497674-12497696 AAAAAAAAGACTAATAGGCCAGG + Intronic
1093920639 12:24855921-24855943 AAAGATGGGATCAGCAGGCCAGG - Intronic
1093988887 12:25568609-25568631 AAAGAATGGTTTAATGGGCCAGG + Intronic
1094058849 12:26292343-26292365 ATAGAAAGGCTAAGTGGGCCAGG + Intronic
1094213306 12:27915329-27915351 AGAGAAACTATTGGTAGGCCAGG + Intergenic
1094382193 12:29855120-29855142 AAAGAAAGATTCAGTTGGCCGGG + Intergenic
1094528117 12:31246449-31246471 AAAAAAAGTAGTTGTAGGCCTGG - Intergenic
1094534405 12:31308233-31308255 TAAAGAAAGATTAGTAGGCCAGG - Intronic
1094655664 12:32417683-32417705 GAAGAAAGAATTAGTAAGCCTGG - Intronic
1096371038 12:51069268-51069290 AAAGAAAGGAGAAGGAAGCCGGG - Intronic
1096471258 12:51877794-51877816 AAAGATAGACTGAGTAGGCCTGG - Intergenic
1097212228 12:57380932-57380954 AAAGAAAGAATGGGCAGGCCGGG + Intronic
1098261709 12:68678187-68678209 AAAGCAAGGCATAGTGGGCCGGG + Intergenic
1098426720 12:70372618-70372640 AACTAAAGGAATAGTAGGTCTGG + Intronic
1099027750 12:77486946-77486968 TAGGAAAGGTTTAATAGGCCAGG + Intergenic
1099424597 12:82506477-82506499 AACCTAAGGAGTAGTAGGCCTGG + Intergenic
1099558918 12:84148520-84148542 AAAGAATGGTTTAGTGGGCTGGG + Intergenic
1100515714 12:95325678-95325700 AAATAAAGAATGAGTAGGCCTGG - Intergenic
1100557506 12:95710705-95710727 AAAAATAGGATGAGTTGGCCAGG + Intronic
1100632922 12:96406376-96406398 AAAAAAAGGATGAAAAGGCCAGG - Intergenic
1100848890 12:98688753-98688775 AAAGAAAAGAGTGGTAGGCTAGG - Intronic
1101635933 12:106541309-106541331 AAAGAATGGTTTCATAGGCCAGG - Intronic
1102204839 12:111083311-111083333 AGAGAAAGGATTAAAAGGCCAGG + Intronic
1103223177 12:119263676-119263698 AAAGAAAGGAGTAATGGGGCAGG - Intergenic
1103286472 12:119805837-119805859 AAAGGAAGAAGAAGTAGGCCAGG + Intronic
1103543976 12:121686535-121686557 AAAGAAAGGAATAGTACACTGGG + Intergenic
1103638952 12:122332714-122332736 AAAGAAAAGATAATAAGGCCGGG - Intronic
1103640048 12:122343426-122343448 AATAAAATGATCAGTAGGCCAGG - Intronic
1103679406 12:122681398-122681420 AATGATAGGATTAGGAGGCAGGG + Intergenic
1103687763 12:122745759-122745781 AAAAAAAAGTTAAGTAGGCCAGG + Intergenic
1103783009 12:123412075-123412097 AAAGAAAGGTTAAGATGGCCTGG - Exonic
1103802016 12:123544335-123544357 AGAGAAATGAATTGTAGGCCGGG - Intergenic
1103982880 12:124748025-124748047 AAAGAATGTATTATCAGGCCGGG + Intergenic
1104737317 12:131143859-131143881 AAAGAAAGGATTTTCCGGCCAGG + Intergenic
1105350587 13:19611658-19611680 AAAAAAAGGATAAGTAGGTGTGG - Intergenic
1105675707 13:22669556-22669578 AAAGAAAAGATGAACAGGCCGGG - Intergenic
1105925791 13:25006696-25006718 AAAGAAATGACAAATAGGCCGGG + Intergenic
1105926727 13:25015501-25015523 ACAAAAAAGATTAGTAGGCCAGG - Intergenic
1106038315 13:26065781-26065803 ATAAAAAAGATTAATAGGCCGGG + Intergenic
1106038910 13:26070920-26070942 AAATAAATGATGAGTAGGCCGGG - Intergenic
1106109434 13:26763393-26763415 AAAGAGTGGATCAGTTGGCCAGG + Intergenic
1106727257 13:32498636-32498658 AAAGAAGTGATTACTAGGTCCGG - Intronic
1107209195 13:37832051-37832073 AAAGAAATGATAAGTAGGTGAGG + Intronic
1108226624 13:48295983-48296005 AAATAAAAGATTAGTATCCCAGG - Intergenic
1108332505 13:49403850-49403872 GAAGAAATGATTAGTAAACCTGG + Intronic
1108346490 13:49551603-49551625 TAAAAAAGCATTAGAAGGCCGGG + Intronic
1108352737 13:49601948-49601970 AAAAAATAAATTAGTAGGCCGGG - Intergenic
1108378560 13:49836140-49836162 AAATAAAGCAGTACTAGGCCGGG - Intergenic
1108669373 13:52668273-52668295 AAAAAAAGGAGTAATAGGCCAGG - Intronic
1108899172 13:55377550-55377572 AAAAAAAGAATTATTCGGCCAGG - Intergenic
1109336997 13:61006633-61006655 AAAGAATGGTTTAGTGGGCCAGG + Intergenic
1109614127 13:64808658-64808680 AAACAAAGGTTTTGTGGGCCAGG + Intergenic
1109637419 13:65140889-65140911 ACAGAAAGTTTTATTAGGCCAGG + Intergenic
1111648559 13:91062365-91062387 AAAGAAAGGATTATTGTGACTGG - Intergenic
1111802585 13:92998574-92998596 AAAAATAGGATTTTTAGGCCAGG - Intergenic
1112923968 13:104650396-104650418 AAAGAATGCAATGGTAGGCCGGG - Intergenic
1113538521 13:111086945-111086967 AAAGAAAGGAACAATGGGCCAGG - Intergenic
1114441803 14:22754426-22754448 ACAGAATGGATTAGTGGGCCAGG - Intergenic
1115462709 14:33679613-33679635 AATGAAAGGACTAGTAGGTATGG + Intronic
1115530689 14:34324178-34324200 AAAGAATGGATAGGTAGGCTGGG - Intronic
1115838639 14:37440140-37440162 TAAGAAATTATTTGTAGGCCAGG - Intronic
1115949307 14:38701813-38701835 ATAGAAAGAATGAATAGGCCAGG + Intergenic
1116264776 14:42674239-42674261 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
1116451964 14:45077237-45077259 TAAGAAAGCATTTGTAGGGCCGG + Intergenic
1116665044 14:47764154-47764176 AATAAAAGGATGAGGAGGCCGGG + Intergenic
1117035192 14:51721314-51721336 TAAGAAAGAACAAGTAGGCCAGG + Intronic
1117228268 14:53686735-53686757 AAAGAAAGGATTATTGGGATAGG - Intergenic
1117685555 14:58249483-58249505 AAAAAAAGGAATAATAAGCCAGG - Intronic
1119058404 14:71447862-71447884 AAAAAAATCAATAGTAGGCCAGG - Intronic
1119120246 14:72068788-72068810 AGAGAAAGGAAGAGTGGGCCGGG - Intronic
1119396858 14:74332648-74332670 AAAAAATAGATTAGGAGGCCAGG - Intronic
1119457704 14:74770326-74770348 AAAAAAAAAATGAGTAGGCCAGG + Intronic
1121465528 14:94113204-94113226 ACAGAAAGTATTAATAGGCCAGG + Intronic
1121563938 14:94894684-94894706 AAAGAAAACAGCAGTAGGCCGGG - Intergenic
1123710750 15:22985836-22985858 AAAAAAAGAAATAATAGGCCGGG + Intronic
1123871972 15:24584732-24584754 AAGGAAAGGATTAGCATGCCAGG + Intergenic
1125143919 15:36443532-36443554 AAAAAAAAGATTAAAAGGCCAGG + Intergenic
1126288027 15:47038339-47038361 AAAGAAAGCATAAACAGGCCCGG - Intergenic
1126635511 15:50776111-50776133 AAAGAAATAACTAATAGGCCAGG + Intergenic
1126802797 15:52315667-52315689 ACAGAAAAAATCAGTAGGCCAGG - Intronic
1127126297 15:55815550-55815572 AAAAAACTTATTAGTAGGCCGGG + Intergenic
1127577551 15:60306587-60306609 AAAGAAATAATCAGAAGGCCAGG - Intergenic
1127991205 15:64119281-64119303 AAAAAAAGAATTAGTCGGCATGG - Intronic
1128269882 15:66299556-66299578 AAAAAAGGGATTACTGGGCCAGG + Intronic
1128278159 15:66371810-66371832 AAAGAAACAATTACCAGGCCAGG - Intronic
1129435683 15:75538399-75538421 AAAGACAGGAATTTTAGGCCAGG + Intronic
1129512162 15:76132402-76132424 AAAAACTGGATTGGTAGGCCAGG - Intronic
1129808171 15:78481944-78481966 AATGAAAGTATAAGTAAGCCAGG + Intronic
1129813852 15:78534544-78534566 TAAGAAGGGATGAGGAGGCCGGG - Exonic
1130614482 15:85391778-85391800 AAAAAAAGAATAAGGAGGCCAGG - Intronic
1130667659 15:85883532-85883554 TAAGAAAGGAGTAGTGGGCTGGG - Intergenic
1130764634 15:86857537-86857559 AAAGTAAGGAATAGTTAGCCAGG - Intronic
1130842929 15:87718700-87718722 AAAGAATAGATGATTAGGCCCGG + Intergenic
1131080428 15:89529997-89530019 TAAGAAAGGTTAACTAGGCCGGG - Intergenic
1131251233 15:90831623-90831645 AAAGAATGGAATGGAAGGCCGGG + Intergenic
1132196176 15:99916288-99916310 AGAGAAAGTATTACAAGGCCTGG - Intergenic
1132440090 15:101853408-101853430 TAAGAAAGAATTAATGGGCCGGG - Intergenic
1132813505 16:1814177-1814199 AAAGAAAAATTGAGTAGGCCGGG + Intronic
1133084762 16:3353503-3353525 AAAAAAAGAATAAGTAGGCCGGG + Intergenic
1134068644 16:11246718-11246740 AAAGAAAGTGATAATAGGCCCGG - Intergenic
1134175344 16:12001720-12001742 AAAGAAAAGACAAGTAGGCCAGG + Intronic
1135087433 16:19486671-19486693 AAAGAAGAGATTAGGAGGCCAGG - Intronic
1135143701 16:19943212-19943234 AAAGAATGTACTATTAGGCCAGG - Intergenic
1135200691 16:20435326-20435348 AAAGAAAGACTTAATCGGCCTGG - Intronic
1135681240 16:24459168-24459190 TAAGAAAGGATTTGTAAGCTGGG - Intergenic
1135775330 16:25253050-25253072 AAAGAAACGATTAGTAATCTGGG + Intronic
1136389003 16:29950300-29950322 AAAGAATGCATTAGAAGGCGTGG - Intronic
1136574667 16:31116491-31116513 AAAGAAAGGACGAGTTGGGCGGG - Intronic
1138109821 16:54314713-54314735 AAAGAAAGGAGTTTTAGGCCGGG - Intergenic
1138432856 16:56980626-56980648 AAAAAAAGAATTATTCGGCCGGG + Intronic
1138986274 16:62332383-62332405 AAAGAAAGAAAAAATAGGCCAGG - Intergenic
1138994965 16:62439668-62439690 AAAGAATGGATGAAAAGGCCTGG + Intergenic
1140058989 16:71551141-71551163 AAAGAAAGAAACAATAGGCCAGG + Intronic
1140125626 16:72115912-72115934 AAAGAAATCATTATCAGGCCAGG - Intronic
1140775304 16:78243840-78243862 AAAGAAGGGAACAATAGGCCAGG - Intronic
1140793908 16:78417520-78417542 AAAAAAAGTATTAATAGCCCTGG + Intronic
1141941188 16:87277215-87277237 AAAGAAAGGAGCAGAAGGCCGGG + Intronic
1142746565 17:1961984-1962006 AAAGAAAAGAAAAGCAGGCCGGG + Intronic
1143878276 17:10010016-10010038 AAAGAAAAGATTAGAAGACTGGG + Intronic
1144368851 17:14570729-14570751 AAAGAATGGTTTCGGAGGCCAGG - Intergenic
1144422654 17:15112165-15112187 AAAGAAAGACATAGGAGGCCGGG + Intergenic
1144791830 17:17864162-17864184 TAAAAAAGGTATAGTAGGCCAGG - Intronic
1144845268 17:18214545-18214567 AAAAAAAAAATTTGTAGGCCGGG + Intergenic
1144886681 17:18467725-18467747 AAAGACAGAAAAAGTAGGCCAGG + Intergenic
1145080138 17:19888149-19888171 AAAGAAAGAAATACTCGGCCAGG - Intergenic
1145145530 17:20476582-20476604 AAAGACAGAAAAAGTAGGCCAGG - Intergenic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145930224 17:28680007-28680029 AAAGAAAGAAAAAGGAGGCCAGG + Intronic
1145955726 17:28853205-28853227 AAAAAAAGAATTACTAGGCATGG + Intronic
1146763456 17:35497887-35497909 AAGGAAAGGATTCTTGGGCCAGG + Intronic
1146803639 17:35847639-35847661 AAAGAAAGGATTTACAAGCCAGG + Intronic
1146967217 17:37042714-37042736 AAAGAAAAAATTAAAAGGCCAGG - Intronic
1147281227 17:39362911-39362933 TAAGAAAAGTTTACTAGGCCAGG - Intronic
1147432965 17:40385303-40385325 AAAGAAATAATGAATAGGCCTGG + Intergenic
1147475791 17:40710372-40710394 ACAGAAAGGATAAATAGGGCAGG - Intergenic
1147760037 17:42791661-42791683 AAAGAAAGATTGAATAGGCCGGG + Intronic
1147874143 17:43608859-43608881 ACAGAAAGGCTAAATAGGCCGGG + Intergenic
1148067200 17:44880347-44880369 AAAGACATGAATAGAAGGCCTGG + Intronic
1148271337 17:46264257-46264279 TAATAAAGAATTTGTAGGCCAGG - Intergenic
1148589038 17:48801653-48801675 AAAGAAAGGCCTATTAGCCCAGG + Intronic
1149057881 17:52387449-52387471 AAAGAATGGTTTAGGGGGCCAGG + Intergenic
1149108225 17:52994918-52994940 AAAGAGAGGATTAGGAGACAGGG + Intergenic
1149271871 17:54988476-54988498 AAAGAAGGGATTTATTGGCCAGG + Intronic
1149480112 17:56996498-56996520 AAAGAAAGGAAAAAGAGGCCAGG - Intronic
1149629321 17:58109072-58109094 AAAGAAATAAATAATAGGCCAGG - Intergenic
1150423617 17:65058985-65059007 AAAGAAAGAAAAAGAAGGCCGGG + Intergenic
1150685592 17:67318323-67318345 AAACAAAGAATTAGCAGGCGTGG - Intergenic
1150736609 17:67745594-67745616 AAAAAAATGATAAATAGGCCGGG - Intergenic
1150895672 17:69208120-69208142 TAAGAATGTATTAGGAGGCCAGG + Intronic
1150909953 17:69377437-69377459 ACAGAAAGGATTAGTACACTAGG + Intergenic
1151024496 17:70661360-70661382 ACAGAAAGGATAAATAGGTCGGG - Intergenic
1151081322 17:71333023-71333045 ATAGAAATGATAAATAGGCCTGG + Intergenic
1151444659 17:74155414-74155436 AAAGAATGGATGGGCAGGCCAGG + Intergenic
1151539175 17:74756242-74756264 AAAGAAAAGAAAAATAGGCCAGG - Intronic
1151606201 17:75137942-75137964 AAAAAAAGGAAAACTAGGCCGGG - Intronic
1151911024 17:77083414-77083436 AAAGAAAGGAAATTTAGGCCAGG - Intergenic
1152028065 17:77824593-77824615 GAAGAGAGGATCAGCAGGCCTGG + Intergenic
1152042421 17:77913138-77913160 AAAAAAAGGATGAGTTTGCCGGG + Intergenic
1152712433 17:81879720-81879742 AAAGAAAGAAATCGTAGGTCAGG + Intergenic
1153218746 18:2844409-2844431 AAAGAATGGAATAATAGGCCGGG + Intergenic
1153671166 18:7413580-7413602 AAAATAAGGATAAATAGGCCAGG - Intergenic
1154128469 18:11715162-11715184 AAAGAAAAGATAACAAGGCCGGG + Intronic
1154472613 18:14719718-14719740 AAAGACTTGAATAGTAGGCCAGG - Intergenic
1154993735 18:21620247-21620269 AAAAAAAAAATTAGTTGGCCGGG - Intronic
1155002073 18:21697366-21697388 AAAAAAAGGATAAATAGGCTGGG - Intronic
1155116384 18:22772511-22772533 ATAGAAAGAATGAATAGGCCAGG + Intergenic
1155164992 18:23224862-23224884 AAAGAAAGAAAAAGAAGGCCGGG - Intronic
1155225785 18:23728028-23728050 AAGAAAAGGTTCAGTAGGCCAGG - Intronic
1155511579 18:26583096-26583118 AAAGAGAGCAAAAGTAGGCCAGG + Intronic
1155749683 18:29405937-29405959 TAACAAAGCATTAGTAGTCCAGG + Intergenic
1156261954 18:35452884-35452906 AAAAAAAGGAATAATAGGCCGGG + Intronic
1156410885 18:36827909-36827931 AAAGAAACGTTTGATAGGCCAGG + Intronic
1156426978 18:37024294-37024316 AAAGAAAGGAATAACAGGCCAGG - Intronic
1157736713 18:50056068-50056090 AAAGAATGGACAAATAGGCCTGG - Intronic
1158211479 18:55055260-55055282 GAAGAAAGGAATATTAGCCCGGG + Intergenic
1158494275 18:57940082-57940104 ATATAAAGGATGTGTAGGCCAGG - Intergenic
1158973685 18:62691531-62691553 AAAGAAAAGAAAATTAGGCCGGG - Intergenic
1159350444 18:67265762-67265784 AAGGAAAGGATTACTGTGCCAGG - Intergenic
1159356645 18:67345179-67345201 ATAGAAAAGGTCAGTAGGCCAGG - Intergenic
1159442521 18:68499812-68499834 AAAGAAAGACATTGTAGGCCGGG + Intergenic
1159687850 18:71445465-71445487 AAAGAAAAGATTAATAAGCTTGG + Intergenic
1159977878 18:74738442-74738464 AAAAAAAGGAGAAGTTGGCCGGG + Intronic
1160711670 19:554557-554579 AAAAAAAGGATAAAAAGGCCAGG + Intergenic
1160742139 19:691522-691544 AAAGAAAAGAAAAGTAGGCCGGG + Intronic
1161093223 19:2373793-2373815 AAAGAAAGCAAAAGTTGGCCGGG - Intergenic
1161175314 19:2839037-2839059 AAAATAAAAATTAGTAGGCCAGG + Intergenic
1161263921 19:3354195-3354217 AAAAAAAAGATTTGTAGGCCAGG - Intergenic
1161330632 19:3685433-3685455 AAAGAAAGTTTTATTGGGCCAGG + Intronic
1161484309 19:4526514-4526536 AAAGAATGGTTAAGCAGGCCAGG - Intronic
1161788550 19:6344007-6344029 AAAGACTTGATAAGTAGGCCGGG + Intergenic
1161839066 19:6667743-6667765 AGAGAAAGGTTTAATAGGTCGGG + Intronic
1162024330 19:7885026-7885048 AAAGAAAGAAAAAGAAGGCCAGG + Intergenic
1162248567 19:9423698-9423720 CAAGAATTGATGAGTAGGCCAGG + Intronic
1162559674 19:11409183-11409205 AAAGAAAAGAAAAGAAGGCCGGG + Intronic
1162571226 19:11474635-11474657 AAATAAAAGAATAATAGGCCAGG - Intronic
1162638097 19:11986151-11986173 AAAGCAAGGAGTTGAAGGCCTGG - Intergenic
1162663713 19:12192357-12192379 AAAAAAAGAATTACTAGGGCCGG - Intergenic
1162723910 19:12678472-12678494 AAAGAAAGAGTAAGTAGGCTGGG + Intronic
1162731230 19:12720312-12720334 AAAGAAAAGATATATAGGCCAGG - Intronic
1162765548 19:12917347-12917369 AAAGAAAAATTTAGTAGGCCGGG - Intronic
1163046082 19:14643437-14643459 AAAGATATGATTACTGGGCCAGG - Intronic
1163261836 19:16195630-16195652 AAAGAAAGGAAAAGAAGGCCAGG + Intergenic
1164316075 19:24088950-24088972 AAAAAAAAGATTAATTGGCCAGG - Intronic
1164826033 19:31285485-31285507 AAAAAAAGGAAAAGTAGGCCAGG + Intronic
1165008741 19:32827673-32827695 AAAGAAAGATTTGGTTGGCCGGG - Intronic
1165078975 19:33297013-33297035 AAAGAAAGGAAAAAGAGGCCTGG + Intergenic
1165088439 19:33368198-33368220 AAAGAACAGATTAGTCAGCCAGG + Intergenic
1165572906 19:36790818-36790840 AAAGAACGAGTTAGTTGGCCGGG + Intergenic
1165776601 19:38408262-38408284 AAAGAAAAGAAAAGTAGGCTGGG + Intronic
1165911864 19:39234032-39234054 AAAAAAAATAATAGTAGGCCAGG + Intergenic
1165948871 19:39461525-39461547 AAAGAAAATAATAATAGGCCGGG + Intronic
1166133650 19:40762510-40762532 AAAGAAATGTGTGGTAGGCCGGG - Intronic
1166217181 19:41343427-41343449 AAAAAAGGGATTAGGGGGCCTGG - Intronic
1167086755 19:47315176-47315198 AAAGAATGGAAAAGTTGGCCAGG - Intronic
1167216170 19:48166673-48166695 AATGAAAGGGTTCCTAGGCCGGG + Intronic
1167256372 19:48432203-48432225 AAAGAAAGAAAAAGAAGGCCGGG - Intronic
1167352049 19:48981645-48981667 AAAGAAAGGAGGGGGAGGCCAGG + Intronic
1167491327 19:49794193-49794215 AAAGAAACAATGAGTGGGCCAGG - Intronic
1167834624 19:52057725-52057747 AAATAAAAGATTAATGGGCCAGG + Intronic
1167907436 19:52673736-52673758 AAATAAAAAATTATTAGGCCAGG + Intronic
1168138585 19:54368980-54369002 AAAAAATGAATTAGTCGGCCGGG - Intronic
1168674517 19:58267403-58267425 CAAGAAAGGGTTACAAGGCCGGG + Intronic
925649520 2:6074339-6074361 AAAGAAGAGATTAGCAGGCCTGG + Intergenic
925980485 2:9173064-9173086 AAAGAAAAGAAAAGAAGGCCGGG + Intergenic
926011419 2:9411424-9411446 TAAAAAAGTATTAATAGGCCGGG + Intronic
926029858 2:9576630-9576652 AAAGAAAGAAATAATTGGCCGGG - Intergenic
926704620 2:15827947-15827969 AAAGAAATGAATACTGGGCCAGG - Intergenic
927537398 2:23874758-23874780 AAAGAAAGGATAATTAGGGCCGG + Intronic
927665621 2:25030428-25030450 AAAGAAAAGAATTGTAGGCTGGG + Intergenic
927716591 2:25357176-25357198 AAAGAAAGAAATACTTGGCCAGG - Intergenic
927727155 2:25434557-25434579 AAAGAAGGGACTACTAGGCCAGG - Intronic
928469941 2:31564464-31564486 AAAGAAAGGAGAAGTAGGGAGGG + Intronic
928494784 2:31820502-31820524 AAAGAATGGTTTTGTGGGCCAGG - Intergenic
928514831 2:32035636-32035658 GAAAAAAGCATAAGTAGGCCAGG + Intronic
928543510 2:32307630-32307652 AAAAACAGGATTTGTAGGCCAGG + Exonic
928658975 2:33481454-33481476 AAAGATAGCATAACTAGGCCAGG - Intronic
928696360 2:33853618-33853640 ACAGAATGGTTTTGTAGGCCAGG - Intergenic
930704997 2:54496139-54496161 AAAAAAAGTATAAATAGGCCAGG + Intronic
930940887 2:57013387-57013409 AAAGAATGGTTTTGTGGGCCAGG + Intergenic
930941097 2:57015102-57015124 AAAGAATGAGTTATTAGGCCGGG + Intergenic
931187332 2:59966073-59966095 AAAAAAAAGATGAGTAGGCCGGG + Intergenic
931764415 2:65442211-65442233 AGAAAAAGGAATAGAAGGCCGGG + Intergenic
933087340 2:78072237-78072259 TAAGAAAGGAAAAGCAGGCCAGG + Intergenic
933168092 2:79096735-79096757 AAAGAAAGGATATGTCTGCCTGG + Intergenic
933494331 2:83029674-83029696 ACAGAAAGGATGAGGAGGCCTGG + Intergenic
935660613 2:105463773-105463795 AAAGAAAGGAAATGTGGGCCGGG + Intergenic
936246436 2:110832241-110832263 AAAGAACAAACTAGTAGGCCGGG + Intronic
936476914 2:112847412-112847434 AAAGAAAAAATTATTTGGCCAGG - Intergenic
937037322 2:118792947-118792969 AAAGAAAGGATTTCAGGGCCAGG + Intergenic
937663972 2:124463355-124463377 AGAGAAAGGAACTGTAGGCCTGG + Intronic
938069515 2:128300987-128301009 AAAGAAAGGAATGGGAGCCCTGG + Intronic
938388822 2:130888177-130888199 AAAAAAATGCTTAGCAGGCCAGG + Intronic
938918028 2:135963665-135963687 AAAGAAGTCATTAATAGGCCAGG - Intronic
939428360 2:142070741-142070763 AAGGAAATGATTAGTTTGCCTGG - Intronic
940611950 2:156004152-156004174 ACAGAAAGAATTACCAGGCCGGG - Intergenic
940716152 2:157226386-157226408 AAACAAAGTATTAGTAAACCCGG - Intergenic
941335716 2:164241023-164241045 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
941414340 2:165200734-165200756 AAGGGAAGGATTAGGAGGCCTGG + Intronic
941657909 2:168164226-168164248 AAAGAAAGGAGTATGAGGCCAGG + Intronic
941944238 2:171077061-171077083 AAATAAAGGATGAGTGGCCCTGG + Intronic
942463198 2:176183739-176183761 AAAAAAAGGATTCCTAGGCCAGG + Intergenic
943522905 2:188976007-188976029 AAAGAAAGGGTGAGGAGGCAAGG - Intronic
943641982 2:190369700-190369722 AATGAAAAGATTGGTAGGCATGG + Intronic
943889746 2:193271511-193271533 AAAGAATGGATGAGAAAGCCTGG - Intergenic
943900100 2:193422850-193422872 AAAGAAAGGTAGAGAAGGCCAGG - Intergenic
944504390 2:200395201-200395223 TAAGAAAGGATTATTAGAACTGG + Intronic
945506200 2:210643737-210643759 TATTAAAGGATTAGTAGGCCAGG - Intronic
945776994 2:214117261-214117283 GAAGAAAGAATTAGTAAGCTTGG + Intronic
945985116 2:216347385-216347407 AAACAAAGGCTTAGTAATCCAGG + Intronic
946055879 2:216901540-216901562 AAAGAATGATTTTGTAGGCCAGG + Intergenic
946445788 2:219738828-219738850 AAAGGATGGCTGAGTAGGCCTGG + Intergenic
947060727 2:226162040-226162062 AATAAAAGAATTAGAAGGCCCGG - Intergenic
947505423 2:230704801-230704823 AAAAAAAGGAAAAGCAGGCCAGG - Intergenic
948440212 2:237982178-237982200 AAAGAAAGGAATGGAAGCCCTGG - Intronic
948442945 2:238008252-238008274 GAATAAAGAATTAATAGGCCAGG - Intronic
1169124586 20:3118175-3118197 AAAGAAACCATTAACAGGCCGGG + Intronic
1169959316 20:11141376-11141398 AAAGAAAAGATTAGAAGGCCTGG - Intergenic
1170619158 20:17979709-17979731 AAATAAAAAATTATTAGGCCCGG - Intronic
1170881198 20:20297722-20297744 AAAGAAAGAAGTAAAAGGCCAGG - Intronic
1172046007 20:32080647-32080669 AAAGAAAAGATTAGTCAGCATGG - Intronic
1172314290 20:33941666-33941688 AAAAAAAAAATTAATAGGCCAGG - Intergenic
1172370550 20:34387005-34387027 AAATAAATGATTTATAGGCCGGG + Intronic
1172376127 20:34442140-34442162 AAAGACAGGATTAAAAAGCCAGG + Intronic
1172449121 20:35009357-35009379 AAAAAAAAGATTGGGAGGCCAGG + Intronic
1172793896 20:37524124-37524146 AAAGAAATGAGTAGTGGGCAGGG + Intronic
1173545707 20:43896220-43896242 AAAGTATGCATTAGGAGGCCAGG - Intergenic
1173817552 20:45999387-45999409 AAAAACACGATTAATAGGCCAGG + Intergenic
1173944049 20:46936174-46936196 AAAAAAAGCCTTATTAGGCCAGG + Intronic
1174027854 20:47593732-47593754 AATGAAAGCATTACTAAGCCAGG + Intronic
1175160424 20:57003971-57003993 AAAGAAAGGAACTCTAGGCCGGG + Intergenic
1176158801 20:63637988-63638010 AAAGAAAGAGTTTGTAGGCCAGG - Intergenic
1176801875 21:13438173-13438195 AAAGACTTGAATAGTAGGCCAGG + Intergenic
1177199134 21:17933743-17933765 ACAGAAAGAAATAGTAGGCCGGG + Intronic
1177226304 21:18261368-18261390 AAAAAAAAGATCAGTAGGCTGGG + Intronic
1177406327 21:20673188-20673210 ACAGAATGGTTTTGTAGGCCAGG + Intergenic
1177444444 21:21174216-21174238 AAAGAAAGGTTTTGTTGGCCAGG - Intronic
1178159217 21:29892532-29892554 GAAGAATGGATTGGCAGGCCAGG + Intronic
1178536768 21:33416525-33416547 AAAGAATAGAAAAGTAGGCCAGG + Intronic
1179232512 21:39518053-39518075 AAAGAAAACATTTGTAGGCTGGG - Intergenic
1180597333 22:16986895-16986917 AGAAAAAGGATTAGTAAACCAGG + Intronic
1180696669 22:17755505-17755527 AAATAAAGGGTTTGGAGGCCGGG + Intronic
1181129643 22:20723313-20723335 AAAAAAGGGAACAGTAGGCCGGG - Intronic
1181878421 22:25958209-25958231 AGAAAAAGGGTTTGTAGGCCAGG - Intronic
1182468186 22:30531110-30531132 AAAGTAAGGAACTGTAGGCCAGG + Intronic
1182769313 22:32782500-32782522 AAAAAAAGAATTACAAGGCCTGG - Intronic
1183091896 22:35527939-35527961 AAAGAAAGAATGAATGGGCCCGG - Intergenic
1183821786 22:40351946-40351968 AAAGAAAGCATTTGGAGGCCAGG - Intronic
1184005692 22:41706893-41706915 AAAGAATGGTTAAGTAGGCCGGG + Intronic
1184324440 22:43772342-43772364 AAAGAAATGAAAAGAAGGCCGGG + Intronic
1184707281 22:46223345-46223367 AAAGAAATAAATAATAGGCCAGG + Intronic
1185404170 22:50636884-50636906 AAGAAAAGGAGGAGTAGGCCCGG + Intergenic
949729420 3:7091177-7091199 AAAGGATTGATTTGTAGGCCTGG + Intronic
949961536 3:9316361-9316383 AAAAAAAAAATTAATAGGCCAGG + Intronic
950325628 3:12106947-12106969 AAAGAAAGGATCACTAGACTAGG + Intronic
950879948 3:16315409-16315431 AAATAAAACATTTGTAGGCCAGG - Intronic
950962182 3:17118603-17118625 AAAGAAAGGGTAAGTAGTCTGGG - Intergenic
950970162 3:17178358-17178380 AAAGAATGGAGCACTAGGCCAGG - Intronic
951127057 3:18996403-18996425 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
951892096 3:27576935-27576957 AAAAAAAAAATTAGCAGGCCTGG - Intergenic
952022439 3:29040085-29040107 AAAAAATGGTTTTGTAGGCCTGG + Intergenic
952378211 3:32784376-32784398 AAAAAAAAGTTCAGTAGGCCAGG - Intergenic
952394041 3:32905451-32905473 TAAAAAAGGTTTATTAGGCCGGG - Intergenic
952427590 3:33191423-33191445 AAAAAAAGGTATACTAGGCCGGG - Intronic
953488148 3:43322655-43322677 AAAGACTGTATTGGTAGGCCGGG + Intronic
953577483 3:44124695-44124717 AAAGAAAGAATTGGTAAGCTGGG + Intergenic
954068790 3:48127947-48127969 AAAAAAAAGATAAGTAGGCCTGG + Intergenic
954925048 3:54226596-54226618 AAAGAAGGGAATTGCAGGCCAGG - Intronic
955194671 3:56794190-56794212 TAAGAAAGTATTACTGGGCCAGG + Intronic
956443959 3:69307632-69307654 AAGAAAAGAAATAGTAGGCCGGG - Intronic
956712004 3:72047339-72047361 AAGGAAAGGAATAGTAAGACGGG + Intergenic
958265216 3:91430160-91430182 GAAAATAGGAGTAGTAGGCCAGG - Intergenic
958560524 3:95742988-95743010 GAAGAATGGTTTTGTAGGCCAGG - Intergenic
958815070 3:98905458-98905480 AAAGAATGGAAGAATAGGCCGGG + Intergenic
958970607 3:100606271-100606293 AAAGAAAGCATTGATAGGCCAGG - Intergenic
960778181 3:121286167-121286189 AAAGAAAGGGATAATAGGCCTGG - Intronic
961502564 3:127347664-127347686 GAAGAAAGCATAGGTAGGCCAGG + Intergenic
961573532 3:127817119-127817141 CAAGAAAGGACTAGAAGGCAAGG + Intronic
962063870 3:131958951-131958973 AAAGAAAGGTGTATCAGGCCGGG - Intronic
962798942 3:138873164-138873186 AAAGAAAATGTTAATAGGCCAGG - Intergenic
962950146 3:140211014-140211036 AAAGAAAGATTTTGTAGGCTTGG + Intronic
963824184 3:149933194-149933216 AAAGAATGGTTTAGTGGGTCAGG - Intronic
964092441 3:152892663-152892685 AAAGAATGGTTTAGTAGGTCAGG - Intergenic
964160053 3:153635986-153636008 AAAGAAAGGATTGCCAGGCATGG + Intergenic
964499082 3:157328335-157328357 AAAAAAAGGATCCCTAGGCCAGG + Intronic
965019067 3:163202765-163202787 TAAGAAAGGCTTAATAGTCCAGG - Intergenic
965057828 3:163744613-163744635 GAAGAATGGTTTTGTAGGCCAGG - Intergenic
965580973 3:170267376-170267398 AAGAAAAGCAGTAGTAGGCCGGG + Intronic
965592117 3:170371203-170371225 TAATAAAGGAGTAGTAGGCCTGG + Intronic
965822836 3:172701757-172701779 TAAGAAAGCAAAAGTAGGCCAGG - Intronic
965903390 3:173671877-173671899 TAAGAAAGGAATAGTTGGCCGGG + Intronic
965905894 3:173705731-173705753 AAAAAAAGGATGGGTAGGCTAGG - Intronic
966129131 3:176616665-176616687 AAAGAAAAGTTTACTTGGCCAGG - Intergenic
966576677 3:181510695-181510717 AAAAAATGGTTTAGTGGGCCAGG + Intergenic
966894238 3:184430608-184430630 AAAGAATAGATGAATAGGCCAGG - Intronic
967047977 3:185755156-185755178 AAAGAACGGTTTAGTGGGCCAGG + Intronic
967555981 3:190859744-190859766 AAAGAAAGTAAAAGTAGACCTGG - Intronic
967748228 3:193083705-193083727 AAAGAATGGTTTTGTAGGTCAGG + Intergenic
968139686 3:196245701-196245723 AAAGTAAAGAATAGGAGGCCGGG + Intronic
968186374 3:196635709-196635731 AAAGAAAGGAGGAGGAGGCCGGG - Intergenic
968513814 4:1007468-1007490 AAAGAAAGGATCAGTGTGGCTGG - Intergenic
968700646 4:2056262-2056284 AAAAAAAGGATTTATTGGCCAGG + Intergenic
971526819 4:27630268-27630290 AAAGAAAGCATTAGTTATCCAGG + Intergenic
971688009 4:29795576-29795598 AAATAAAGAATTGGTTGGCCAGG + Intergenic
972005810 4:34103118-34103140 CAAAAAAGGAAAAGTAGGCCAGG - Intergenic
972026559 4:34386029-34386051 AATGAAAGGATTTGTAGGTGGGG - Intergenic
972193082 4:36618279-36618301 AAAAAAAAAATTAGAAGGCCAGG + Intergenic
972478318 4:39474275-39474297 AAAAAAAGAATAAATAGGCCAGG + Intronic
972605422 4:40609283-40609305 AAATAAAAAATTAGCAGGCCAGG - Intronic
973262754 4:48181376-48181398 AAAAAAAGGATTGGAAGGGCTGG + Intronic
974037609 4:56830568-56830590 AAAGAAAGAAATTGTAGACCAGG + Intergenic
974041309 4:56860292-56860314 AAAGAAAAGAAAACTAGGCCAGG + Intergenic
974057775 4:57001454-57001476 AAAGAAAGGCCGAGGAGGCCAGG - Intronic
974606657 4:64160453-64160475 AAAGAACTGATTATAAGGCCAGG + Intergenic
974624779 4:64411195-64411217 AAAAAAAGGAATAGTTGGCTGGG + Intergenic
975956799 4:79850311-79850333 AAACAAATGATTGTTAGGCCTGG + Intergenic
976286466 4:83375698-83375720 AAAGAATGGTTTCGTGGGCCAGG - Intergenic
976287605 4:83385271-83385293 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
977520333 4:98074650-98074672 AAAGAGAGAATTAGTAAGCTTGG - Intronic
977750017 4:100598586-100598608 AGAGAAAGGATGAAGAGGCCTGG + Intronic
977874110 4:102129184-102129206 AAAGAATGGTTTAGGGGGCCAGG + Intergenic
978027187 4:103891733-103891755 AAAAAAGTGATAAGTAGGCCAGG + Intergenic
978161508 4:105553673-105553695 AAAGAAAGGATAGATAGGACAGG - Intronic
978198472 4:105997701-105997723 AAAAGAAGGATTTGGAGGCCGGG + Intronic
978584326 4:110261398-110261420 AGAGAAAGGAATCGTAGCCCAGG - Intergenic
979373282 4:119914613-119914635 GAAGAAAGGTTTTGTGGGCCAGG - Intergenic
979464682 4:121022494-121022516 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
979596838 4:122543689-122543711 AAAGAATTTATTAGAAGGCCTGG - Intergenic
980975845 4:139609638-139609660 AAAGGAAGAAATAGTTGGCCGGG - Intergenic
981574295 4:146188205-146188227 ATAGAAAGGACTAGAAAGCCAGG - Intronic
982417770 4:155157163-155157185 AAAGAATGGTTTAGTGGGCCAGG + Intergenic
982765886 4:159347923-159347945 AAATAAAGGGATAGTAGGCTGGG + Intronic
982773914 4:159422952-159422974 TCAAAAAGGATTAGCAGGCCAGG + Intergenic
983067659 4:163229766-163229788 AAAGAATAGATTTTTAGGCCAGG + Intergenic
983128652 4:163986558-163986580 AAAGAAAGAAGAAGTTGGCCGGG - Intronic
983347683 4:166547311-166547333 TAAGTAAGCATTAGTAGGACTGG + Intergenic
983353711 4:166628734-166628756 AAAGAAAGGATTTGTTGCCACGG + Intergenic
983762229 4:171425158-171425180 AAAGAAAAGGTTTTTAGGCCGGG - Intergenic
983959028 4:173730247-173730269 AAAGAATGGATTAGAAGGACGGG + Intergenic
984374634 4:178911960-178911982 AAAGAAAGGAAAGGTAGGCCAGG + Intergenic
984792220 4:183625463-183625485 AAAAAAAGCAGGAGTAGGCCGGG + Intergenic
984940660 4:184929472-184929494 AAAGAACCAGTTAGTAGGCCGGG - Intergenic
985237438 4:187891693-187891715 AAAAGATGGATAAGTAGGCCAGG + Intergenic
985504421 5:271005-271027 AAAGAAAGCAAAAGCAGGCCGGG - Intergenic
985582891 5:708999-709021 AAAGAATGGCTTAATGGGCCAGG + Intergenic
985596567 5:794250-794272 AAAGAATGGCTTAATGGGCCAGG + Intergenic
987398947 5:17454719-17454741 GAAGAAAAGATCAGTAAGCCTGG + Intergenic
987943163 5:24568814-24568836 AAAGAAAGGATTTCTTGTCCAGG + Intronic
988532020 5:32036242-32036264 AAAGAAAGGTTGATGAGGCCGGG - Intronic
988720085 5:33869119-33869141 AAAGAATGGTTTTGTGGGCCAGG + Intronic
989229114 5:39066356-39066378 AAAGAATGGTTTTGTGGGCCTGG - Intronic
989245683 5:39251624-39251646 AAAAAAAGGATTAGTATACAGGG - Intronic
990013119 5:51024142-51024164 AAAGGAAGGGTTAGTAGGCAAGG + Intergenic
990035385 5:51311814-51311836 GAAGAAAGGTTTAGGAGGCTTGG + Intergenic
990263926 5:54055654-54055676 ATAGAAAGGAATGATAGGCCAGG - Intronic
990724813 5:58741707-58741729 AAAAAAAGGATAAGTTGGCCAGG + Intronic
991593924 5:68283054-68283076 GAAGAAATGATTCTTAGGCCTGG + Intronic
991919159 5:71637037-71637059 AAAGAATGTATTAATTGGCCAGG - Intronic
991921879 5:71665367-71665389 AAAAAAGGGAGTATTAGGCCAGG + Intergenic
992157655 5:73970955-73970977 GGAGGAAGGATTAGTAGGCTGGG + Intergenic
992384865 5:76274986-76275008 AAAGAAAATTTTAGTTGGCCAGG + Intronic
992574216 5:78094974-78094996 TAAGAAAGCATCAGTTGGCCAGG - Intronic
992892431 5:81215564-81215586 AAAGAACTGACAAGTAGGCCGGG - Intronic
993134568 5:83942392-83942414 AAAGAAATGATGAGTATGCTTGG + Exonic
993238265 5:85344616-85344638 AAAAAATGGTTTTGTAGGCCAGG + Intergenic
993517494 5:88856568-88856590 AAAAAAAGGTTTTGTGGGCCAGG + Intronic
993729006 5:91400537-91400559 AAAGAAGGGAAGAGAAGGCCGGG - Intergenic
994357579 5:98811194-98811216 AAAGAAAGTACTTTTAGGCCAGG - Intergenic
995630551 5:114127534-114127556 AAAAAATGGTTTTGTAGGCCAGG - Intergenic
996235789 5:121127911-121127933 AAAGAATGGTTTAGTGGGCCAGG + Intergenic
997150864 5:131493357-131493379 TAAGAAATGATAAGTAGGTCGGG - Intronic
997206826 5:132055053-132055075 AAAGAAAAGATCAGTAAGGCTGG + Intergenic
997467551 5:134098518-134098540 AAAGAAAGGAATCCTTGGCCGGG - Intergenic
997535540 5:134618020-134618042 AAAAAAAAGATTTGTTGGCCGGG + Intronic
997679829 5:135742374-135742396 AAATAACGGATTCCTAGGCCAGG - Intergenic
997940775 5:138155458-138155480 AAAAAAAAGTTTAGTTGGCCAGG + Intronic
998338600 5:141396321-141396343 AAAAAAACTATTATTAGGCCGGG + Intronic
998519664 5:142788294-142788316 AAAGAACTGATTAATTGGCCGGG - Intronic
998603772 5:143612558-143612580 AAAGAAAAGATTGATTGGCCAGG - Intergenic
998866275 5:146506064-146506086 AAAAAAAGGATAAAAAGGCCGGG - Intronic
999396921 5:151235379-151235401 AAAGAAAGGAAGACCAGGCCGGG + Intronic
999756145 5:154665967-154665989 AGAGAAAGGAAAAGGAGGCCTGG - Intergenic
1000882696 5:166716017-166716039 AAAGAAAAGAGTTTTAGGCCGGG + Intergenic
1001605599 5:172957967-172957989 AAACCTAGTATTAGTAGGCCAGG + Intergenic
1001682027 5:173565089-173565111 AAAGAAAGGATGGGCAGGCATGG + Intergenic
1002602095 5:180359818-180359840 AAAGAAAAGAAAAGCAGGCCAGG + Intergenic
1003132266 6:3404963-3404985 AAAAAAAAGATTTGTCGGCCAGG + Intronic
1003990827 6:11484598-11484620 AAAGAAAGCATTAGGAGAACTGG - Intergenic
1004040233 6:11967940-11967962 AAAGAAAGGAAGAGGTGGCCAGG - Intergenic
1005583762 6:27256706-27256728 CAAGGAAGGATTAGAAGGCAAGG - Intergenic
1005660040 6:27988405-27988427 AAAGAAAGAATTATTAGGCTGGG - Intergenic
1005933631 6:30502097-30502119 AAAAAAAGAATTTCTAGGCCAGG - Intergenic
1006324075 6:33340019-33340041 AAAGAAAAGAAAAGAAGGCCAGG + Intergenic
1006758426 6:36438113-36438135 TAAGAAAGCATTAATAGGCCGGG - Intronic
1006844915 6:37055523-37055545 AGAGAAAGGATTGGTTGGCCTGG - Intergenic
1007417691 6:41701647-41701669 TCAGAAAGGTTAAGTAGGCCAGG + Intronic
1007444028 6:41890415-41890437 AATTAAAGTATTAGGAGGCCAGG + Intronic
1007760539 6:44130910-44130932 AAAAAAAGTAGTAGTAGGCAGGG - Intronic
1007805419 6:44441001-44441023 AAAGAAGGGATTTTTAGGCTGGG - Intronic
1008117429 6:47568444-47568466 TAAGAAACGATGAGTAGGCTGGG + Intronic
1008990163 6:57592497-57592519 GAAAATAGGAGTAGTAGGCCAGG + Intronic
1009178738 6:60491036-60491058 GAAAATAGGAGTAGTAGGCCAGG + Intergenic
1011142089 6:84170076-84170098 AAAAAAAGCATAAGTAGGCCAGG + Intronic
1011679586 6:89770108-89770130 AAAAAAAGAATTAAGAGGCCGGG + Intronic
1011771592 6:90679293-90679315 AGAGAAAGGGTTAGAAGGCTGGG + Intergenic
1011913940 6:92478306-92478328 AAAGAAAGAATTAATAAGCTGGG + Intergenic
1012210185 6:96509739-96509761 AAAGAATGGTTTTGTAGACCAGG + Intergenic
1012485363 6:99715458-99715480 AAAGAAAGAATGAGTAAGACTGG - Intergenic
1012940493 6:105409920-105409942 AAAGAATGGTTTTGTGGGCCAGG - Intergenic
1013295901 6:108758200-108758222 AAAGAAAGAACTAGTAGGACAGG - Intergenic
1013630582 6:111982424-111982446 CAAGAATGGATTACAAGGCCAGG - Intergenic
1014066600 6:117134311-117134333 AAAGAAAGGAAAAGTAGCACAGG + Intergenic
1014668601 6:124271509-124271531 AAAGAAAGGAGGTTTAGGCCGGG - Intronic
1015524131 6:134159561-134159583 ATAAAATGGCTTAGTAGGCCAGG - Intergenic
1015783304 6:136894161-136894183 AAAAAAAGTAATAATAGGCCAGG + Intronic
1016028964 6:139317973-139317995 AAAGAAAGGATTATGGGGCCGGG + Intergenic
1016069228 6:139718506-139718528 AAAGAAAGTATGAGTAGGCCGGG - Intergenic
1016460436 6:144275571-144275593 AAAAAAAAGGTTAGAAGGCCAGG + Intergenic
1016943899 6:149510053-149510075 AATAAAAGTAGTAGTAGGCCAGG - Intronic
1017030703 6:150218945-150218967 AATAAAAGAATAAGTAGGCCAGG - Intronic
1017757921 6:157545379-157545401 AAAAAAAGGAGGAGGAGGCCGGG + Intronic
1018632216 6:165831087-165831109 TAAGAAAGGATTGCCAGGCCGGG + Intronic
1019496702 7:1343966-1343988 AAAGAAAAGAGGTGTAGGCCGGG + Intergenic
1020068062 7:5204969-5204991 AAAAAAAAGACTAATAGGCCGGG - Intronic
1020203447 7:6097883-6097905 AAAGAAAGAAAAAGAAGGCCGGG - Intergenic
1020230581 7:6315259-6315281 AAAAAAAGAAATAGTCGGCCAGG - Intergenic
1020231614 7:6323486-6323508 AAAATAAGCATTATTAGGCCGGG + Intergenic
1021192956 7:17643589-17643611 AAAGAATGGTTTTGTGGGCCAGG + Intergenic
1021925198 7:25527833-25527855 ATGGAGAGGATTAGTTGGCCTGG + Intergenic
1022004489 7:26255051-26255073 AAAGAATGCATTTGGAGGCCAGG - Intergenic
1022846376 7:34214306-34214328 AAAGAAACTACTAGAAGGCCGGG + Intergenic
1023465532 7:40450221-40450243 AAAAAAAAGTCTAGTAGGCCGGG - Intronic
1023972000 7:44998930-44998952 ATATAAAGAATTATTAGGCCGGG + Intergenic
1024274618 7:47667734-47667756 AAAGAAAAGGTGAGTTGGCCAGG + Intergenic
1024843933 7:53620319-53620341 AAAAAATGGTTTAGTGGGCCAGG + Intergenic
1026061524 7:67030903-67030925 AAAAAAAAAATTAGTTGGCCTGG + Intronic
1026243718 7:68599454-68599476 AATGAAGGAATTAGTAGGCTGGG + Intergenic
1026246025 7:68620543-68620565 AAAAAATAGATTAGTAGGCCTGG + Intergenic
1026312952 7:69203814-69203836 AAATAAAGAATAAATAGGCCGGG - Intergenic
1026331323 7:69354965-69354987 AAAAAAATTATTTGTAGGCCGGG - Intergenic
1026651738 7:72221928-72221950 AAAGAAAAGAGTTTTAGGCCAGG + Intronic
1026688487 7:72532900-72532922 AAAGAAAGAAATAATAAGCCAGG - Intergenic
1026716826 7:72796529-72796551 AAAAAAAAAATTAGTTGGCCTGG - Intronic
1027055317 7:75045807-75045829 TAAGAAAGGAAGAGAAGGCCAGG - Intronic
1027356258 7:77358889-77358911 AAAGAAACTATTAATAGGCTAGG + Intronic
1027657203 7:80945191-80945213 AAAGAAATAATAAATAGGCCGGG - Intergenic
1027888247 7:83937387-83937409 AAAGACAGGATTAAGAGGTCTGG + Intergenic
1027904806 7:84165846-84165868 TAAGAAGGTATTGGTAGGCCGGG - Intronic
1027979603 7:85200791-85200813 AAAAAATGGTTTAGTGGGCCAGG + Intergenic
1028661598 7:93283529-93283551 TAAGAAAAGCTCAGTAGGCCAGG - Intronic
1029403200 7:100358028-100358050 AAAAAAAGGATTTGAAGTCCTGG + Intronic
1030699060 7:112618955-112618977 AAAGAAAGGAATGGTGGGCCAGG + Intergenic
1031158145 7:118135243-118135265 AAAGAGTGGTTTCGTAGGCCGGG + Intergenic
1031171633 7:118299035-118299057 AAAGAATGAATTAGTTGGCTTGG + Intergenic
1031238243 7:119205117-119205139 AAAAAAAGACTTAATAGGCCAGG + Intergenic
1031261983 7:119532976-119532998 AAAGAATGGCTTTGTGGGCCAGG + Intergenic
1032065694 7:128768541-128768563 AAAGAAATGTTTAATTGGCCTGG + Intronic
1032216949 7:129964853-129964875 AAAGAAAAAAACAGTAGGCCGGG - Intergenic
1032736902 7:134700960-134700982 AAAGAAAGGAACATGAGGCCGGG - Intergenic
1033774792 7:144596987-144597009 AAAGAAAGAAATTGGAGGCCAGG + Intronic
1033835044 7:145300257-145300279 AAAGAAATAATTTGTGGGCCAGG + Intergenic
1034229511 7:149510702-149510724 AAAGCAATAATTACTAGGCCGGG + Intergenic
1034502045 7:151456918-151456940 AAAGAAAGGTTTTGTGGGCCAGG - Intergenic
1034911085 7:154999427-154999449 AAAGAAAGGATTGGGTGGGCTGG + Intronic
1035157048 7:156922866-156922888 GAAGAAAGGGTTAACAGGCCAGG + Intergenic
1036060500 8:5313069-5313091 AAAGAAAGGATGAGTAAGTTAGG - Intergenic
1037364012 8:18103613-18103635 AAAGAATGGTTTCATAGGCCAGG + Intergenic
1038763476 8:30406185-30406207 AAAAAAAAGATTAGCAGGCATGG + Intronic
1039046042 8:33450234-33450256 CAAGAAAGGCTTCATAGGCCGGG - Intronic
1039710570 8:40052028-40052050 GAAAAAAAGATTAGTGGGCCAGG - Intergenic
1039761417 8:40580305-40580327 GAAGAAAAGATGAATAGGCCGGG - Intronic
1039852415 8:41380645-41380667 AAAAAAAGAATTTGTTGGCCAGG - Intergenic
1040008829 8:42643967-42643989 AAAGAATGAATTGGGAGGCCGGG + Intergenic
1040096788 8:43453064-43453086 TAAGAAAGGATCAGAAGCCCTGG - Intergenic
1040097940 8:43466357-43466379 AAAGAATGGTTTTGTGGGCCAGG - Intergenic
1040479113 8:47807711-47807733 AAAAAAAAAATAAGTAGGCCGGG - Intronic
1040906558 8:52475097-52475119 CAACAAAGGATTAGCAAGCCTGG + Intergenic
1040950076 8:52929655-52929677 AAAGAACGAATTGATAGGCCGGG - Intergenic
1041160667 8:55040078-55040100 TAAGAAAGGAAAATTAGGCCGGG + Intergenic
1041346581 8:56905086-56905108 AGAGAAAGCATTACTAGGCCTGG + Intergenic
1041697257 8:60749075-60749097 AAATAAAGAATTACAAGGCCGGG + Intronic
1041853063 8:62416049-62416071 AAAGAAATAATTCTTAGGCCAGG - Intronic
1041970765 8:63739662-63739684 AAAGAAAGAATGAGTAGGGTTGG + Intergenic
1042177750 8:66053922-66053944 AAAAAAAAGGGTAGTAGGCCAGG - Intronic
1042973547 8:74437973-74437995 ATAGAAGGGCTGAGTAGGCCGGG + Intronic
1043125300 8:76386724-76386746 AAATAATGGATTAGTAGGCTTGG - Intergenic
1043152416 8:76734441-76734463 AAAGAAAAAAATATTAGGCCAGG - Intronic
1043253193 8:78101822-78101844 AAAAAATGGATGAATAGGCCAGG + Intergenic
1043661535 8:82748687-82748709 ACAGAAAGCATCAGCAGGCCAGG + Intergenic
1043950579 8:86304649-86304671 AAAGAATGGATGAGTAGGAGGGG + Intronic
1044838063 8:96314889-96314911 AAAAAAAAGCTTTGTAGGCCAGG - Intronic
1045025141 8:98079832-98079854 AAATAATGGAAAAGTAGGCCGGG - Intronic
1045084636 8:98669288-98669310 AAAGATAAGATTAATGGGCCGGG - Intronic
1046234484 8:111404437-111404459 ATAAAAAGAATTAGTAGGCCAGG - Intergenic
1046589254 8:116186429-116186451 AAATAACTGATTAGTATGCCTGG + Intergenic
1046917067 8:119689236-119689258 CAAGAAAGGATTTGTAGGCCAGG + Intergenic
1047103282 8:121704638-121704660 AAAGTGAGGATAATTAGGCCAGG - Intergenic
1047586871 8:126282691-126282713 AAAAAAAGGTTTTGTGGGCCAGG + Intergenic
1047653215 8:126947308-126947330 AAAGAATGGATGAGTCGGCCAGG + Intergenic
1048789483 8:138086348-138086370 AAAGAAAGGTTTTATTGGCCAGG + Intergenic
1049727783 8:144157970-144157992 AAAGAAAGAAATAGATGGCCAGG - Intronic
1049754684 8:144304932-144304954 AAAAAAAGGATTAAAATGCCTGG - Intronic
1050439082 9:5641658-5641680 GAAGAAAGAATTAGTGGGCTTGG - Intronic
1050980860 9:12013294-12013316 AAAAAAAGGATTATGAGGCTTGG - Intergenic
1051284144 9:15477841-15477863 AAAAAAAAGATTTGTAGGCTAGG + Intronic
1051506413 9:17831986-17832008 AAGGAAAGGACAACTAGGCCTGG - Intergenic
1051789013 9:20778513-20778535 AAAGAAAGAATTGGTCGGCCGGG - Intronic
1052288632 9:26817672-26817694 AAAGAAAGCAGTAGTTGGCTGGG + Intergenic
1053088582 9:35251257-35251279 AAAAAATGGAAGAGTAGGCCGGG - Intronic
1053205465 9:36182629-36182651 AAAGGTAGAATGAGTAGGCCAGG + Intergenic
1053421467 9:37982495-37982517 AAAAAATGGATAAGTAGGCCGGG + Intronic
1056166583 9:83946892-83946914 AAAAAAAAAATTTGTAGGCCAGG - Intronic
1056289429 9:85127847-85127869 TAAGAAAGAATAAGGAGGCCAGG + Intergenic
1056409029 9:86306972-86306994 AAAGAATACATTAATAGGCCGGG + Intronic
1056811625 9:89769474-89769496 AAAAAAAAGAATAGGAGGCCGGG - Intergenic
1057238041 9:93381538-93381560 ATAGATAGAATTAGTAGGCAAGG + Intergenic
1057586492 9:96333299-96333321 AAAGTATGGAATTGTAGGCCGGG + Intronic
1057617732 9:96606859-96606881 AAAAAAATTATTAGTAGGCCAGG - Intronic
1059676999 9:116549283-116549305 AAAGAAAGGAATGGGAGGTCAGG + Intronic
1061143759 9:128784880-128784902 AAAAAAAAAATTAGAAGGCCAGG + Intergenic
1061347269 9:130036748-130036770 AGAAAAAGGAGCAGTAGGCCGGG + Intronic
1061378007 9:130237420-130237442 AGAGAAAGAATGTGTAGGCCGGG + Intergenic
1061556255 9:131371395-131371417 AAAAAAAAAATTTGTAGGCCGGG - Intergenic
1061578145 9:131520551-131520573 AGTGAAAGCATTGGTAGGCCGGG + Intronic
1061702153 9:132424110-132424132 AAAAAAAGAGTTAGGAGGCCGGG + Intronic
1061997113 9:134192158-134192180 AAAGAATGAATGAGTGGGCCAGG - Intergenic
1062222904 9:135428337-135428359 AAAGAAAAGAGAAGGAGGCCAGG + Intergenic
1062519414 9:136951548-136951570 AAAGAAAGGATTAGTAGGCCAGG - Intronic
1185526522 X:784628-784650 AAAGAAAGGAAGAGAAGGGCAGG - Intergenic
1185665101 X:1759418-1759440 AAAGAAGGAATTTGGAGGCCAGG + Intergenic
1185791780 X:2932695-2932717 CAAGAAAGAAATAGTAGGCCAGG - Intergenic
1186425273 X:9459703-9459725 AAAAAATGGAGTAGAAGGCCAGG + Intergenic
1186806554 X:13145913-13145935 AAAGAATGGCATAGTGGGCCAGG + Intergenic
1187371545 X:18712045-18712067 AAAAAAAGCTATAGTAGGCCTGG - Intronic
1188707114 X:33348216-33348238 AAAGAAAGCAGGAGTAGGCCAGG - Intergenic
1189004069 X:36977311-36977333 AGAGAAATGATAAGTATGCCAGG + Intergenic
1189016058 X:37097424-37097446 AAAAAAAAGATTAGCAGGCATGG + Intergenic
1189044931 X:37580523-37580545 AAAGAAATGATAAGTATGCCAGG - Intronic
1189457935 X:41211284-41211306 AAAGAATGTAAGAGTAGGCCAGG - Intronic
1190109451 X:47580638-47580660 AAAAAAAGATTTAGAAGGCCGGG + Intronic
1190286589 X:48965578-48965600 AAAGAATGGATGAAGAGGCCAGG + Intronic
1190294049 X:49014003-49014025 AAAAAAAAAATTTGTAGGCCGGG + Intergenic
1190662319 X:52666159-52666181 AAGGAAAGGATTTGGAGGCCAGG + Intronic
1191845957 X:65548328-65548350 AAAGAAAAGAATATTAAGCCGGG - Intergenic
1191857265 X:65637105-65637127 AAAGAAAAGAATATTAGGCCGGG + Intronic
1192120142 X:68447731-68447753 AAAAAAAAAATTTGTAGGCCAGG + Intergenic
1192457409 X:71288394-71288416 AAAGAAAAGATAAATAGGCTGGG - Intronic
1193099518 X:77592926-77592948 AAAGAAAGAATAATCAGGCCAGG + Intronic
1193273306 X:79554660-79554682 AAAGAAAGATTTAGTGGGTCAGG + Intergenic
1193570580 X:83136931-83136953 AAAGAAATAAGAAGTAGGCCAGG - Intergenic
1194352729 X:92840367-92840389 AAAAAAGGGATTAATGGGCCTGG - Intergenic
1194551654 X:95308580-95308602 AAAGAAATAATCAGCAGGCCAGG + Intergenic
1194681141 X:96854714-96854736 AAAGAGAGGATTTGTATGCCAGG + Intronic
1195061991 X:101205375-101205397 ATAAAAAGAATTAGTTGGCCAGG + Intergenic
1195141078 X:101960737-101960759 AAAGAATGGATTAGAAGTCAAGG - Intergenic
1196292175 X:113955680-113955702 AGAAAAATGATTTGTAGGCCGGG + Intergenic
1196786255 X:119423917-119423939 AAAGAAAGAAATTATAGGCCGGG + Intronic
1197201277 X:123750925-123750947 AAAGAAAAGAAAAGAAGGCCGGG + Intergenic
1197550937 X:127891953-127891975 AAAAAAAAGTTTCGTAGGCCGGG + Intergenic
1197847770 X:130821763-130821785 AAAAAAAGAATAAGTAGGGCAGG + Intronic
1197863050 X:130990633-130990655 AAAGAAAGGATAAGTATGTGAGG + Intergenic
1198162363 X:134020282-134020304 AACAAAAGGATAAGCAGGCCGGG + Intergenic
1198465344 X:136900037-136900059 AAAGAAAGGAAATCTAGGCCAGG - Intergenic
1198589522 X:138161776-138161798 AAAAAAAGGATTCTTAGGCTGGG + Intergenic
1198629298 X:138616977-138616999 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
1199289944 X:146094045-146094067 GAAGAATGGATTTGTGGGCCAGG - Intergenic
1199413966 X:147558404-147558426 AGAAAAAGGGTAAGTAGGCCAGG - Intergenic
1199593827 X:149491602-149491624 CCAGAAAGTATAAGTAGGCCAGG - Intronic
1199802579 X:151266088-151266110 CAAGAAAAGATTTTTAGGCCGGG - Intergenic
1200159862 X:154001008-154001030 GAATAAAGAAGTAGTAGGCCAGG - Intergenic
1200414226 Y:2891062-2891084 AAACAAAGGATCTTTAGGCCAGG + Intronic
1200661034 Y:5957109-5957131 AAAAAAGGGATTAATGGGCCTGG - Intergenic
1201281872 Y:12349578-12349600 CAAGAAAGAAATAGTAGGCCAGG + Intergenic
1201306531 Y:12555621-12555643 TAAGAATGGATTCCTAGGCCAGG + Intergenic