ID: 1062519416

View in Genome Browser
Species Human (GRCh38)
Location 9:136951553-136951575
Sequence GCCTAAAAGAAAGGATTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062519416_1062519420 -9 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519420 9:136951567-136951589 CTTTTAGGCAGGACCAGCATGGG No data
1062519416_1062519419 -10 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data
1062519416_1062519423 11 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519423 9:136951587-136951609 GGGGTGCCCACTCCCATTAGTGG No data
1062519416_1062519421 -8 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519421 9:136951568-136951590 TTTTAGGCAGGACCAGCATGGGG No data
1062519416_1062519425 13 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519425 9:136951589-136951611 GGTGCCCACTCCCATTAGTGGGG No data
1062519416_1062519424 12 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519424 9:136951588-136951610 GGGTGCCCACTCCCATTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062519416 Original CRISPR GCCTAAAAGAAAGGATTAGT AGG (reversed) Intronic
902830760 1:19010770-19010792 GGCCAAAAGAAAGGAGGAGTGGG + Intergenic
904545526 1:31267856-31267878 GCCGACAGGTAAGGATTAGTGGG - Exonic
907061010 1:51425034-51425056 GTCTAAAATAGAGGATGAGTAGG - Intronic
911749059 1:101475270-101475292 GCCAAAAATAAATCATTAGTAGG + Intergenic
917298577 1:173548715-173548737 GCCAAAAAGAAACAAATAGTTGG - Intronic
919964210 1:202505029-202505051 TCCTTAAAGAATGGATTATTTGG + Intronic
921375940 1:214473710-214473732 GGCTAAAAGAAGGGATGAGGTGG + Intronic
923423316 1:233842980-233843002 GCCTAAAAGCAGGGATTTGAAGG + Intergenic
923967183 1:239155115-239155137 GTCTAAAAGAAAGGATGGTTAGG + Intergenic
1063256926 10:4338736-4338758 GGTTAAAAGAAGGGACTAGTAGG + Intergenic
1063848267 10:10155889-10155911 GGCTAAAAGAAGGAATTACTGGG - Intergenic
1063967175 10:11355194-11355216 GAGTAAAAGAAAGGATAACTGGG - Intergenic
1065040762 10:21692975-21692997 GATTAAAAGAAAGATTTAGTGGG - Intronic
1066392056 10:34985491-34985513 GCCTAAAAGGAAGAATTTGGAGG - Intergenic
1068859927 10:61837766-61837788 ACCTGAAAGTAAGGTTTAGTAGG + Intergenic
1069115828 10:64505137-64505159 GACTAGAGAAAAGGATTAGTTGG + Intergenic
1069252058 10:66280215-66280237 GCAGAAAAGATAGGATTTGTTGG - Intronic
1070095631 10:73335474-73335496 GCATAAAGAAAAGGATTATTTGG - Exonic
1070605354 10:77894593-77894615 GTTTAAAAGAAAGGGTTACTTGG - Intronic
1073988888 10:109240872-109240894 CACTAAAAGAAAGAACTAGTTGG + Intergenic
1078721410 11:13887492-13887514 CCATAAAAGAAAAGATTAGTAGG - Intergenic
1079323751 11:19473999-19474021 GACTAAAAAGAAGGAATAGTGGG - Intronic
1082186965 11:49194353-49194375 GCCTAAGAGAAATGATCAGGAGG + Intronic
1083751645 11:64764157-64764179 GCCTGACAGGCAGGATTAGTTGG + Intergenic
1084707819 11:70825839-70825861 GCCTAAAAGAAGGAAACAGTTGG - Intronic
1085429301 11:76433246-76433268 GGCTTAAACAATGGATTAGTTGG - Intergenic
1086679373 11:89651035-89651057 GCCTAAGAGAAATGATCAGGAGG - Intergenic
1087796057 11:102455448-102455470 GCCTAAGAGAAAAGGTTAGAGGG - Intronic
1094684577 12:32698404-32698426 GCCTAAAAGGAAGGACCAGGAGG - Intronic
1097204570 12:57309297-57309319 GCATGAAGGAAAGGATTTGTTGG + Intronic
1099272866 12:80534702-80534724 GCCTATAATAAAGTATTAGAGGG + Intronic
1100604555 12:96140884-96140906 GCCTAGAATAGAGAATTAGTTGG - Intergenic
1102561681 12:113766696-113766718 CCCTAAAAGAAGGGGCTAGTGGG + Intergenic
1106675071 13:31949757-31949779 GGCTCCAAGAAAGAATTAGTTGG + Intergenic
1106830933 13:33582354-33582376 GCCTAATAGAGATGAGTAGTTGG + Intergenic
1107164344 13:37267546-37267568 GCCTAAAAGAAAATGTTTGTTGG - Intergenic
1107209193 13:37832046-37832068 ACCAAAAAGAAATGATAAGTAGG + Intronic
1110486172 13:76046530-76046552 GCCCAATAGAAAGCATTAGTTGG - Intergenic
1114775365 14:25475070-25475092 GCCGAAAAGAGAGGATGAGTTGG - Intergenic
1115065802 14:29258065-29258087 GCTTAACAGAAAGCATTACTGGG + Intergenic
1116043317 14:39712752-39712774 GCCCAAAAGATACCATTAGTTGG + Intergenic
1117469812 14:56031705-56031727 ACATAAAAGAAAAAATTAGTTGG - Intergenic
1117602164 14:57387239-57387261 GTATAATAGATAGGATTAGTGGG + Intergenic
1118421357 14:65608437-65608459 GCCTAAATGAAATGATTACACGG - Intronic
1119190958 14:72681365-72681387 GCCTAAGAGAGAGGATTCCTGGG - Intronic
1121793021 14:96712948-96712970 GCCTAGAACAGAGGATTACTTGG + Intergenic
1124423449 15:29541905-29541927 GCGTAAAAGATAGGCTTATTTGG - Intronic
1126150359 15:45518202-45518224 GCCAAAAAAAAAAGAATAGTAGG - Intronic
1126383581 15:48071888-48071910 TCCTAAATGAAAGGATTTGGTGG - Intergenic
1126862602 15:52901604-52901626 GCATGAAAAAAAGGATGAGTAGG - Intergenic
1127312050 15:57761013-57761035 GCCAGAAAGAGATGATTAGTAGG + Intronic
1128691128 15:69725742-69725764 GCATGAGAGAAAGGATTAGTCGG + Intergenic
1130291265 15:82603531-82603553 GCTTGAAAGAAAGCATTAGAAGG + Intronic
1135087435 16:19486676-19486698 CCCTAAAAGAAGAGATTAGGAGG - Intronic
1136023002 16:27451752-27451774 ACCTGAAAGGAGGGATTAGTAGG + Exonic
1138307645 16:55992678-55992700 GCCTAAAACCAGAGATTAGTGGG + Intergenic
1138358051 16:56401408-56401430 ATTTAAAAGAAAGGATTAGCGGG - Intronic
1146664037 17:34684997-34685019 GCCTCAGAGGAAGGTTTAGTGGG - Intergenic
1156508437 18:37614490-37614512 ACCTAAAAGCAAGGACCAGTGGG - Intergenic
1157652864 18:49353316-49353338 GCCAAAGAGCAGGGATTAGTTGG - Intronic
1158320927 18:56263769-56263791 GCTTAATAGAAAAAATTAGTAGG - Intergenic
1164207388 19:23070355-23070377 GCCGAAAAGAAAGGATTGCCTGG + Intergenic
1168265903 19:55224024-55224046 GCCAAGAAGAAAGGAGTAGGTGG - Intergenic
925662027 2:6212825-6212847 GTCTAAAAGGAAAGGTTAGTCGG - Intergenic
926410501 2:12597389-12597411 GCTTTATAGAAAGGATCAGTGGG + Intergenic
929125462 2:38519338-38519360 GCCTAATTGTAAGGATTACTGGG + Intergenic
931910141 2:66890058-66890080 TGCTAAAAGAAAGGATTTTTGGG - Intergenic
933889981 2:86759157-86759179 ACCTAACAGACAGCATTAGTGGG - Intronic
934944639 2:98530322-98530344 GGCCAAGAGAAAGGATTAGATGG + Intronic
935613120 2:105046718-105046740 ACCTAAAAGAAAGTCTTTGTGGG + Intronic
936416901 2:112323816-112323838 GCCTGAAAAAGAGGACTAGTAGG + Intronic
936627897 2:114168079-114168101 GCTTAAAAGAAAGAGATAGTTGG + Intergenic
936675811 2:114712597-114712619 TTCAAAAAGAAAGCATTAGTAGG + Intronic
938057459 2:128227158-128227180 GCCTTAATGAATGGATTAATGGG + Intergenic
943009491 2:182430051-182430073 GCAAGAAAGAAAGGATTAGATGG + Intronic
944160259 2:196652405-196652427 GGCTAAAAGAAAGGAGCAATGGG + Intronic
944511682 2:200471900-200471922 GCCTCAAAGAAAGGTCTAGCTGG + Intronic
945011621 2:205470009-205470031 GCCAAAAAGAAAAGGATAGTGGG - Intronic
945121685 2:206463623-206463645 GCCGAAAAGGAAGGTTTAGGAGG + Intronic
945726412 2:213476127-213476149 GCCAAAAAGATAATATTAGTGGG - Intronic
1169362701 20:4964490-4964512 GCCTAAAATAGAGGACTGGTTGG + Intronic
1172793891 20:37524119-37524141 GCCCCAAAGAAATGAGTAGTGGG + Intronic
1173362382 20:42356239-42356261 ACATAAAATAAAGGGTTAGTAGG + Intronic
1173735910 20:45361226-45361248 GCCTAAAAGAATGGTTGAGCTGG + Intergenic
1174251626 20:49224171-49224193 ACCTAAAAGAAAGGATTCAGCGG - Intronic
1175045117 20:56097635-56097657 GGCTCAAAGCAAGGATTTGTTGG - Intergenic
1177089548 21:16750015-16750037 GCCTAAAAGAAATAATATGTAGG - Intergenic
1177310055 21:19378796-19378818 GCTGAAAAGAAGAGATTAGTAGG - Intergenic
1177326291 21:19593702-19593724 ACTTAAATGAAAGGATTAGGAGG + Intergenic
1177830204 21:26130128-26130150 TCCAAAAAGAAAGGAATAGATGG + Intronic
1178175197 21:30089078-30089100 GCCTACAAGAAAGTTTTAGCTGG + Intergenic
1178496797 21:33093172-33093194 TCCTCAAAGGTAGGATTAGTGGG - Intergenic
1178726701 21:35058828-35058850 GAATAAAAGAAAGGAGTAGGAGG + Intronic
953231493 3:41069069-41069091 GCCTAAAACAAAGAATTATCTGG - Intergenic
956042268 3:65156826-65156848 TCCTAAAAGAATAAATTAGTAGG - Intergenic
956874021 3:73444360-73444382 GCTTAAATGAAAGGAGTAGGAGG - Intronic
957916321 3:86692529-86692551 GCCTAAAGGCAAGTAATAGTAGG + Intergenic
958912014 3:100004723-100004745 ACCTAAAAGGTAGGATTGGTGGG + Intronic
958968284 3:100583053-100583075 GCTTAAAAGAAAAGTTTACTTGG + Intergenic
962485040 3:135834085-135834107 GCCTAATACAGAGTATTAGTTGG - Intergenic
963095351 3:141532828-141532850 GAATATAAGAAATGATTAGTGGG - Intronic
968725316 4:2245198-2245220 TCTTAACAGGAAGGATTAGTGGG - Intergenic
969180060 4:5433476-5433498 GCCTTGAAGAAAGTATCAGTGGG + Intronic
970435010 4:16024861-16024883 GCCAAAAAGAAAGGATAATAAGG + Intronic
980801092 4:137751225-137751247 GAATAAAAGAAAGGATTTATTGG - Intergenic
981069028 4:140515573-140515595 GATTAATAGAAAGCATTAGTGGG + Intergenic
981947770 4:150369130-150369152 GCCCAAAAGTAAGTATTACTAGG + Intronic
982111379 4:152059007-152059029 GTCTAAAAGAAAGGATAAGAAGG + Intergenic
983518450 4:168680575-168680597 GCCTAATAGTAAAGATCAGTGGG - Intronic
984523776 4:180831788-180831810 GCCTTAGAGAGACGATTAGTAGG - Intergenic
984920268 4:184757847-184757869 GCCCAAAAGAGAGGATTTGAAGG - Exonic
984972731 4:185205157-185205179 GCCTAAAAGACAGCATTGGCTGG + Intronic
987007377 5:13724322-13724344 GGCCAAAAGAAAGGAATAGTAGG - Intronic
987499880 5:18696291-18696313 TGCTAAAAGAAAGGGTGAGTAGG + Intergenic
988663472 5:33299377-33299399 GCTTCAAAGAAAGGATGATTTGG - Intergenic
989484708 5:41976492-41976514 GCCAAAAAGAAAGGGGTAATAGG + Intergenic
990089983 5:52031726-52031748 GCAAATAAGAAATGATTAGTAGG + Intronic
992192251 5:74304714-74304736 GCCTAACAGAAAAGACTAGATGG + Intergenic
993054530 5:82967180-82967202 GCCTGAAAGAAATGATTTGCTGG + Intergenic
994103568 5:95920754-95920776 AATTAAAAAAAAGGATTAGTTGG + Intronic
995603353 5:113823260-113823282 GCTGAAAAGAAAGTATTTGTGGG + Intergenic
995957974 5:117802744-117802766 GATTAAAAAAAAGGATTTGTAGG + Intergenic
996166802 5:120233930-120233952 GCCTAAAAGAATGAGTTAGGTGG + Intergenic
996856275 5:128011101-128011123 GCCTAATAAAGAGGATTAGCTGG + Intergenic
997935229 5:138104865-138104887 GCCTATAAAAAAGCAATAGTCGG + Intergenic
999754050 5:154651479-154651501 GCCAAAAAGAATGGATTCCTTGG - Intergenic
1003860394 6:10317397-10317419 GCCTAATAGAAATGATCAGAGGG + Intergenic
1004001633 6:11601910-11601932 GCCTAACAGAAAGGAACAGCAGG - Intergenic
1004012690 6:11704331-11704353 GCCACAAACCAAGGATTAGTGGG + Intergenic
1006844916 6:37055528-37055550 GGCTCAGAGAAAGGATTGGTTGG - Intergenic
1007561258 6:42810140-42810162 TCCTAAAAGCAAGGAGGAGTGGG - Intronic
1009057822 6:58359243-58359265 GACTAAAATAAAGGAAAAGTAGG - Intergenic
1009233007 6:61087850-61087872 GACTAAAATAAAGGAAAAGTAGG + Intergenic
1012994233 6:105957685-105957707 GCCTAAAAGAAATTATTGTTTGG + Intergenic
1013489888 6:110635836-110635858 GCTTAAAAGAAAAGGATAGTTGG - Intronic
1014709755 6:124793122-124793144 GCCGAAATGACATGATTAGTGGG + Intronic
1017158942 6:151347707-151347729 GCATTAAAGAAAGTATTAATTGG + Intronic
1019038348 6:169082214-169082236 GACTAAACGAATGGATGAGTGGG - Intergenic
1021823302 7:24519426-24519448 GCCTAAACTGAAGGATTAGAGGG + Intergenic
1025754749 7:64327625-64327647 TACTAAAAGAAAGGATGAATGGG - Intronic
1027512916 7:79105713-79105735 GTCTAAAAAAAATGGTTAGTCGG - Intronic
1028794932 7:94892225-94892247 GCCTAAAAGAAGAGATAATTAGG + Intergenic
1030312910 7:108086061-108086083 GCCCAAAAGAAGGGGTCAGTCGG - Intronic
1031500243 7:122505750-122505772 GCCCAAAAGATAGCATTAATAGG - Intronic
1033980152 7:147154293-147154315 GCATAAAAGAAATGAGTAGCAGG + Intronic
1037219327 8:16498523-16498545 GCCTACAAGAAAGAATTATCTGG + Intronic
1039835671 8:41254478-41254500 TCCTAAAAGAAATGATAAATAGG + Intergenic
1041488303 8:58403595-58403617 GACAAAAACAGAGGATTAGTTGG + Intergenic
1041678791 8:60565129-60565151 GCCTATAAGAAATGATTGCTGGG + Intronic
1043164928 8:76891788-76891810 GCGAAAGAGAAAGGATGAGTGGG - Intergenic
1045428410 8:102089711-102089733 GCCTAAACTAAAGGATTAAAGGG + Intronic
1047323107 8:123807753-123807775 GGCCAAAAGAAAGGATTTGTTGG + Intronic
1047653214 8:126947303-126947325 GTCTTAAAGAATGGATGAGTCGG + Intergenic
1052392726 9:27899940-27899962 GCCTGATAGAAGGGATTAGAAGG - Intergenic
1056236203 9:84597259-84597281 GCCTAGAAGGAAGGATGAATGGG - Intergenic
1056334037 9:85548637-85548659 GATTAAAAGAAATGATTATTTGG + Intronic
1058608238 9:106746550-106746572 GACAAAAAGGAAGGATTAATGGG - Intergenic
1059136778 9:111814815-111814837 TCCTAAAAGTAATTATTAGTAGG - Intergenic
1061560411 9:131398814-131398836 TCTTAAAAGAAAAAATTAGTAGG + Intronic
1062519416 9:136951553-136951575 GCCTAAAAGAAAGGATTAGTAGG - Intronic
1186459015 X:9733627-9733649 GAAAAAAAGAAAGGATTATTGGG + Intronic
1195465453 X:105174057-105174079 ACCTAAAAAAAAGGATTGGTTGG - Intronic
1195671000 X:107469976-107469998 GGCTAATAGAAACGATTACTGGG - Intergenic
1195864559 X:109415253-109415275 GCCTAACAGAAAGAATTTGCTGG + Intronic
1195890936 X:109694494-109694516 ATGTAAAAGAAAGAATTAGTGGG + Intronic
1196194444 X:112825071-112825093 GCCTAAAAGAAAGCAGAAATAGG - Intronic
1196645651 X:118115684-118115706 GCCTGAGAGAGAGGATTGGTGGG - Intronic
1197903758 X:131401244-131401266 CCCTAAAAGAGAGGCATAGTAGG - Intergenic
1202299856 Y:23400862-23400884 TCCTTAAAGAATGGATTATTTGG + Intergenic
1202570954 Y:26269736-26269758 TCCTTAAAGAATGGATTATTTGG - Intergenic