ID: 1062519419

View in Genome Browser
Species Human (GRCh38)
Location 9:136951566-136951588
Sequence TCTTTTAGGCAGGACCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062519416_1062519419 -10 Left 1062519416 9:136951553-136951575 CCTACTAATCCTTTCTTTTAGGC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data
1062519414_1062519419 -5 Left 1062519414 9:136951548-136951570 CCTGGCCTACTAATCCTTTCTTT 0: 1
1: 0
2: 4
3: 87
4: 666
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data
1062519413_1062519419 3 Left 1062519413 9:136951540-136951562 CCTCTGTGCCTGGCCTACTAATC 0: 1
1: 13
2: 104
3: 1082
4: 5800
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data
1062519411_1062519419 30 Left 1062519411 9:136951513-136951535 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062519419 Original CRISPR TCTTTTAGGCAGGACCAGCA TGG Intronic
No off target data available for this crispr