ID: 1062520250

View in Genome Browser
Species Human (GRCh38)
Location 9:136954647-136954669
Sequence TCCCTCTGGGTCCCCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 452}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062520238_1062520250 6 Left 1062520238 9:136954618-136954640 CCCCAGGTCCCCTGTCCCGGGCC 0: 2
1: 1
2: 5
3: 39
4: 398
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520242_1062520250 -3 Left 1062520242 9:136954627-136954649 CCCTGTCCCGGGCCATCTCCTCC 0: 1
1: 0
2: 5
3: 29
4: 368
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520230_1062520250 25 Left 1062520230 9:136954599-136954621 CCTGGGCTACCTCCTCCCACCCC 0: 1
1: 1
2: 5
3: 94
4: 842
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520241_1062520250 -2 Left 1062520241 9:136954626-136954648 CCCCTGTCCCGGGCCATCTCCTC 0: 1
1: 0
2: 7
3: 49
4: 490
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520244_1062520250 -9 Left 1062520244 9:136954633-136954655 CCCGGGCCATCTCCTCCCTCTGG 0: 1
1: 0
2: 3
3: 73
4: 544
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520235_1062520250 9 Left 1062520235 9:136954615-136954637 CCACCCCAGGTCCCCTGTCCCGG 0: 3
1: 0
2: 7
3: 45
4: 421
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520246_1062520250 -10 Left 1062520246 9:136954634-136954656 CCGGGCCATCTCCTCCCTCTGGG 0: 1
1: 0
2: 6
3: 56
4: 666
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520232_1062520250 16 Left 1062520232 9:136954608-136954630 CCTCCTCCCACCCCAGGTCCCCT 0: 1
1: 2
2: 23
3: 212
4: 1382
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520240_1062520250 4 Left 1062520240 9:136954620-136954642 CCAGGTCCCCTGTCCCGGGCCAT 0: 1
1: 1
2: 4
3: 17
4: 246
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520239_1062520250 5 Left 1062520239 9:136954619-136954641 CCCAGGTCCCCTGTCCCGGGCCA 0: 2
1: 1
2: 5
3: 21
4: 275
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520234_1062520250 10 Left 1062520234 9:136954614-136954636 CCCACCCCAGGTCCCCTGTCCCG 0: 1
1: 3
2: 6
3: 42
4: 421
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520233_1062520250 13 Left 1062520233 9:136954611-136954633 CCTCCCACCCCAGGTCCCCTGTC 0: 1
1: 2
2: 7
3: 102
4: 832
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520229_1062520250 30 Left 1062520229 9:136954594-136954616 CCTGTCCTGGGCTACCTCCTCCC 0: 1
1: 2
2: 7
3: 61
4: 428
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452
1062520243_1062520250 -4 Left 1062520243 9:136954628-136954650 CCTGTCCCGGGCCATCTCCTCCC 0: 1
1: 1
2: 4
3: 41
4: 477
Right 1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG 0: 1
1: 0
2: 1
3: 39
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062520250 Original CRISPR TCCCTCTGGGTCCCCTGTCC TGG Intronic
900167720 1:1250367-1250389 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
900168083 1:1252559-1252581 CCCCTCTGGTGGCCCTGTCCGGG - Intergenic
900220391 1:1505647-1505669 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
900294658 1:1942840-1942862 ACCCTCTGGGTCCCCCCTCGTGG - Intronic
900438372 1:2641895-2641917 TCTCTCTGTGTCCTCTGTGCAGG - Exonic
900628545 1:3621335-3621357 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
900648194 1:3718395-3718417 TCCCTCTGGGTCTCCGGGCAGGG - Intronic
900664039 1:3801640-3801662 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
901040952 1:6363213-6363235 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
901432512 1:9225694-9225716 TTACTCAAGGTCCCCTGTCCTGG + Intergenic
902141710 1:14362129-14362151 TCTCTGTGGGTCTGCTGTCCAGG + Intergenic
902184048 1:14711822-14711844 GCCCTCTGAGTCCTTTGTCCCGG - Intronic
902616907 1:17628771-17628793 TCCCTCTGGGTACTCCTTCCTGG - Intronic
903280117 1:22245548-22245570 TCCGTCTGGGACCCCTGCTCTGG + Intergenic
903974769 1:27142189-27142211 CTCCTCTCGGTCCACTGTCCAGG + Intronic
904083278 1:27885518-27885540 TGCCTCTGGTGGCCCTGTCCAGG + Intronic
904287424 1:29461441-29461463 TCCTTCTGGCTGCCCTGGCCCGG + Intergenic
904379459 1:30101270-30101292 TTCCACTGTGCCCCCTGTCCCGG - Intergenic
904445970 1:30573257-30573279 TTCTTCTGGGTCTCCTGGCCAGG + Intergenic
904617891 1:31759818-31759840 TCCTTCTAGGTCCCCTTCCCGGG - Intronic
904746093 1:32712211-32712233 GCCCTCTGGGACCGCTGTCTGGG + Intergenic
904983335 1:34524769-34524791 TCCCTCTACCTCCCCAGTCCAGG + Intergenic
905791203 1:40790733-40790755 TCTCTCTGGCTCCCTGGTCCTGG - Intronic
905835548 1:41117355-41117377 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
905920264 1:41714588-41714610 ACCCTCTGTGTCCCCTGACCTGG - Intronic
907268637 1:53277493-53277515 TCCACCTGAGTCCCCTGGCCTGG + Intronic
907322206 1:53611465-53611487 TCCCTCTTGGTCCTGTCTCCTGG + Intronic
908788946 1:67761949-67761971 TCCCACTGGGTCTGCTTTCCTGG - Intronic
909003593 1:70248946-70248968 GCCCTCTGTGACCCTTGTCCTGG - Intronic
909455239 1:75842672-75842694 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
911529526 1:99028172-99028194 TCCCTGAGGCTGCCCTGTCCTGG + Intergenic
911958122 1:104263342-104263364 GCCCTCTGGTGGCCCTGTCCAGG + Intergenic
913448986 1:118979750-118979772 TCCCTCAGGGTTCCGGGTCCCGG + Intronic
914378892 1:147098558-147098580 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
914991770 1:152505046-152505068 TCCCTCTGAGTCCCACGCCCCGG + Intergenic
919786679 1:201262488-201262510 TCCCTCTGGGTCCCTGGCCCTGG - Intergenic
921720307 1:218463826-218463848 TCTTTCTTGGTCCCCTCTCCAGG + Intergenic
922753465 1:228081898-228081920 TCCCTCTGTGTTCCGTGTGCTGG - Intergenic
923315119 1:232772976-232772998 TCCCACTGTGTCCCCTCCCCTGG + Intergenic
924528885 1:244876757-244876779 TCCCTCTGGCACCACTGACCTGG - Intergenic
924605739 1:245533280-245533302 TCCATCTGCCACCCCTGTCCTGG + Intronic
924657373 1:245985132-245985154 TCCCTTTTGGTCTCCCGTCCTGG + Intronic
1062823310 10:550833-550855 TCCCTCTGGGACCCCAGGCCTGG + Intronic
1063362255 10:5468312-5468334 TGCCTCTGCTTACCCTGTCCAGG + Intergenic
1063532146 10:6843805-6843827 TCCCTTTGGGTCAGCTGACCTGG - Intergenic
1063664829 10:8055021-8055043 TCCCTCGGGGACACCGGTCCCGG - Intronic
1063787494 10:9402242-9402264 TCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1063909522 10:10815159-10815181 ACCCTCTGGAGCCCCTGCCCTGG + Intergenic
1063985282 10:11495124-11495146 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1064018762 10:11792927-11792949 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1065417551 10:25504597-25504619 TCCCACTGGGTCTACTTTCCCGG + Intronic
1065565091 10:27000158-27000180 TCTATCTGGGTCCTCTGCCCAGG - Intronic
1066439719 10:35426945-35426967 TGCCTCTGGGCTCCCTGTCTTGG + Intronic
1067103294 10:43348815-43348837 TCCCTTTGTGTCCCCTCTCCAGG - Intergenic
1067673302 10:48346408-48346430 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1074844942 10:117389462-117389484 TCCCTCTCCCTCCCCTGGCCTGG + Intergenic
1076060136 10:127407684-127407706 TCCCTCTCTGGCACCTGTCCAGG + Intronic
1076628825 10:131840323-131840345 GCCCTCTGGTGGCCCTGTCCTGG + Intergenic
1076655003 10:132018089-132018111 TCGCTGTGGGTCCCCAGCCCTGG - Intergenic
1076813750 10:132903489-132903511 TCCATCTGGGCCCGCTCTCCAGG + Intronic
1076851430 10:133095326-133095348 ACCCTCAGGGGCCTCTGTCCAGG + Intronic
1076862282 10:133144041-133144063 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1076894747 10:133304877-133304899 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1076896267 10:133313981-133314003 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1076902810 10:133348066-133348088 TCCCCGTGGGTCCCCTCTCCAGG - Intronic
1077183296 11:1225847-1225869 CCTCCCTGGGTCCCCTGCCCAGG + Intronic
1077194047 11:1270500-1270522 TCCCTCTGGAACCCTGGTCCTGG + Intergenic
1077300779 11:1846045-1846067 CCCCTCTGGGACCCCACTCCTGG - Intergenic
1077394832 11:2315726-2315748 TGCCTCTGGGTGCCATGCCCTGG + Intronic
1079001237 11:16758611-16758633 TCTCTCTGGGTCTCCTTTCTGGG + Intergenic
1082261359 11:50078101-50078123 TGCCTCTGGGTGGCCTATCCAGG - Intergenic
1083326152 11:61873967-61873989 TCCCTGTGGGTTCCCTTCCCTGG + Intronic
1083502936 11:63128266-63128288 GCCCTCTGGTGGCCCTGTCCAGG - Intronic
1083910508 11:65706399-65706421 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1084019724 11:66410259-66410281 CACCTCTGGGTCCCCCATCCCGG - Intergenic
1084452123 11:69245402-69245424 TCACTCAGGGCCCACTGTCCTGG + Intergenic
1084972736 11:72780650-72780672 TCCCTCAGGGACCCCTCTGCTGG - Intronic
1086897765 11:92333445-92333467 TCCCTCTTGGTCCCAGGTCCCGG - Intergenic
1088230786 11:107671616-107671638 ACCCTCTGAGGCCCATGTCCAGG - Intergenic
1088729825 11:112670974-112670996 TCCCACTGGGAGCTCTGTCCAGG - Intergenic
1088911183 11:114193629-114193651 TCCTCCTGGGACCCCTTTCCTGG - Intronic
1090360001 11:126165600-126165622 TCCCTCTGGGGCCCCATCCCAGG - Intergenic
1091691305 12:2599283-2599305 TCCCACTGGGTCCCTCTTCCCGG + Intronic
1092073878 12:5656929-5656951 AATGTCTGGGTCCCCTGTCCTGG - Intronic
1092444125 12:8537972-8537994 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1092579174 12:9820455-9820477 TCCCACTGGGAACTCTGTCCAGG - Intergenic
1092871358 12:12808686-12808708 TCCATCTGAGTCCCCTTTTCAGG + Intronic
1093624224 12:21327099-21327121 TCCTTCTGGGTCCCATGGCTGGG - Intronic
1097089902 12:56496856-56496878 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1097090608 12:56501420-56501442 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1098935404 12:76473064-76473086 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1102039933 12:109794232-109794254 TCCTTCTGGGTCCCCTGTAGGGG - Intronic
1102467604 12:113139050-113139072 CCCCTGTGGGCCCTCTGTCCAGG + Intergenic
1102739117 12:115190528-115190550 TCCCTTTGGGTTTCCTGCCCAGG + Intergenic
1103357925 12:120335598-120335620 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1103701162 12:122849391-122849413 TCCCTGTGGGTACCCGGTCCAGG - Intronic
1103884245 12:124188981-124189003 TCCCGCAGGCTCCCCTGCCCTGG + Intronic
1103930495 12:124448283-124448305 TTGCTCTGGGGCCCCTGTCTGGG - Intronic
1104803854 12:131572488-131572510 TCCCTCTGGCTCTCCATTCCGGG - Intergenic
1104871528 12:132001713-132001735 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1104878291 12:132051945-132051967 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1105043053 12:132977056-132977078 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1106049338 13:26175678-26175700 TCCCTCTTGGATCCCTGTCCTGG - Intronic
1106182735 13:27382272-27382294 TACCTCTGTGGCCCCTGCCCTGG - Intergenic
1107930021 13:45299484-45299506 TCACTCTAGGTCCCATTTCCAGG + Intergenic
1108505424 13:51108411-51108433 TTCCTTCTGGTCCCCTGTCCCGG + Intergenic
1112165169 13:96910416-96910438 TCCCCCTGGATCCCCTCACCGGG + Intergenic
1113183756 13:107662186-107662208 TCCCTTGGTGTCCCCTGGCCTGG + Intronic
1113880290 13:113621651-113621673 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1113966694 13:114156562-114156584 GTCCTTTCGGTCCCCTGTCCTGG + Intergenic
1114080771 14:19200267-19200289 TCCTTCTGTGTCCTCTGTGCAGG - Intergenic
1114590822 14:23863222-23863244 TCCCCCTGGTGCCACTGTCCAGG + Intergenic
1114658069 14:24328085-24328107 GCCCTCTGGTGGCCCTGTCCAGG - Intronic
1115175989 14:30562455-30562477 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG + Intergenic
1117479919 14:56132459-56132481 TCCCTGTGGGACTCCTGTCGTGG + Intronic
1117993699 14:61459120-61459142 TCCCTCTTGGTGCCTTCTCCAGG - Intronic
1119183503 14:72620082-72620104 TCTCACTGGATCCCCTTTCCAGG + Intronic
1119197032 14:72724679-72724701 CCCCTCTGGGCCCCCTGACATGG - Intronic
1119717735 14:76870616-76870638 ACTCTCTTGGTCTCCTGTCCTGG - Intergenic
1120183608 14:81369772-81369794 TTGCTCTGGGCCCCCTTTCCAGG - Intronic
1121035375 14:90699049-90699071 TCCCTCTCGACCCTCTGTCCTGG + Intronic
1121482811 14:94291619-94291641 TCTCTCTGGGCCCACTGCCCTGG + Intronic
1121631868 14:95427169-95427191 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1122400581 14:101465072-101465094 TCCCTCTGGGGCCCCTTGCATGG + Intergenic
1122755217 14:103973390-103973412 TCCCTGTGGTTCCCCCGACCTGG + Intronic
1122756044 14:103980821-103980843 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1123025643 14:105422434-105422456 TCCATCTGGGTGGCCAGTCCTGG + Intronic
1123193286 14:106591929-106591951 GCCCTCTGGTCGCCCTGTCCAGG + Intergenic
1202893464 14_KI270722v1_random:181950-181972 GCCCTCTGGTGGCCCTGTCCAGG - Intergenic
1202921035 14_KI270723v1_random:30713-30735 TCCCTCAGGGCCCCATGTGCAGG - Intergenic
1123815164 15:23970658-23970680 TCCCCCTGGGTCATCTGACCAGG + Intergenic
1123887027 15:24736215-24736237 TCCCTTTGGGTCCCCTGTCTTGG - Intergenic
1124497024 15:30192920-30192942 TCCCTCTTTCTCCCCTCTCCAGG - Intergenic
1124746552 15:32345727-32345749 TCCCTCTTTCTCCCCTCTCCAGG + Intergenic
1125418382 15:39477046-39477068 CCCCGCTGGGACCTCTGTCCAGG - Intergenic
1125483912 15:40099118-40099140 AACCTCTGGGGCCCCTGCCCGGG + Intronic
1125765239 15:42131116-42131138 TCCCTTGGGGTCCCATATCCTGG - Intergenic
1127286655 15:57539073-57539095 CCCCTCTGGGTCTCCTGGCCGGG + Intronic
1128747264 15:70123365-70123387 TCCCTTGGGTTCCCCTTTCCTGG - Intergenic
1129372850 15:75109013-75109035 TGTCTCTGGGTCTACTGTCCTGG - Intronic
1129883787 15:79025039-79025061 GCCCTCTGGCTCCTCTGCCCAGG + Intronic
1129921164 15:79320186-79320208 GCCCTCTGGCGGCCCTGTCCAGG + Intronic
1130024852 15:80262193-80262215 TCCCTCAGGGCCACCTGCCCTGG - Intergenic
1130030319 15:80308124-80308146 TTCCTCTGGGAGCTCTGTCCCGG + Intergenic
1131535179 15:93231510-93231532 TTCCTCAGGGGCCCCTTTCCTGG + Intergenic
1132247449 15:100308792-100308814 TCCCTCTGTGTCCCCTGGGGTGG - Intronic
1132404640 15:101535095-101535117 TCCCTCGGGGTCCCCCTTCCTGG - Intergenic
1132621714 16:870961-870983 TCCCTAAGGGTCAGCTGTCCTGG + Intronic
1132639162 16:969928-969950 AACCTCTGGATCCCCTGGCCAGG - Intronic
1132966870 16:2660979-2661001 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1133010376 16:2907249-2907271 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1133250351 16:4476605-4476627 GCCCTTTGGGTCCCCTGCGCCGG + Intronic
1134382395 16:13740131-13740153 GCCCTCTGGTGGCCCTGTCCAGG - Intergenic
1135733792 16:24915143-24915165 CTTCTCTGGGTCCTCTGTCCAGG - Intergenic
1136191245 16:28616082-28616104 GCCCTCTGGTGGCCCTGTCCAGG + Intronic
1136319144 16:29471278-29471300 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1136433715 16:30210622-30210644 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1136612832 16:31377684-31377706 TGCCTGTGGGTCCCCTGCCAAGG - Intronic
1136621028 16:31428296-31428318 TGCCTCTGAGGCCCCTGACCCGG - Exonic
1137229876 16:46554519-46554541 GCCCTCTGGTGGCCCTGTCCAGG - Intergenic
1137393368 16:48099701-48099723 TCCCCCTGGGTCCTCCTTCCTGG + Intronic
1137598696 16:49741907-49741929 TCCCTATGGGACCACTTTCCAGG + Intronic
1137896616 16:52219538-52219560 TTCCTCAGGGACCCCTTTCCTGG + Intergenic
1138239541 16:55416022-55416044 TCAGTCTGGGTCCCCTGTGCAGG + Intronic
1138592018 16:58005434-58005456 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1138923067 16:61556199-61556221 TCCCTCTTGGAGCTCTGTCCAGG - Intergenic
1140038591 16:71390201-71390223 TCCCTCTCGCTCCCCTCTGCCGG + Exonic
1140673494 16:77303089-77303111 TCACTCAGGATGCCCTGTCCTGG + Intronic
1140765608 16:78154077-78154099 TCCCTTTGTGTTCCCTGTCTGGG + Intronic
1141856335 16:86683646-86683668 TCCCTCAGGGTCCTCAGGCCAGG + Intergenic
1142384255 16:89752740-89752762 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1142390036 16:89793293-89793315 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1143839376 17:9719593-9719615 TCCCTCTGGGTGCCAGGTCTTGG + Intronic
1144676165 17:17163253-17163275 TCCCTCTCGGTCTGCTGGCCGGG - Intronic
1144953438 17:19005698-19005720 TGCCTCTGAGTCCACTGCCCTGG + Intronic
1145206655 17:20988006-20988028 TACCTCTGGGTCCCCTCCCCTGG - Intergenic
1146064145 17:29622187-29622209 CTCCTCTGGGTCCTCTGCCCTGG + Intronic
1146454901 17:33001895-33001917 GCCTTCAGGGTCCCTTGTCCAGG - Intergenic
1146578203 17:34013062-34013084 TCCATCAGGTTCCCCTCTCCAGG - Intronic
1148401090 17:47362354-47362376 GCCCTCTGGTGGCCCTGTCCAGG - Intronic
1148470550 17:47890333-47890355 TGCCCCTGGTTCCCCTGTCCAGG - Intergenic
1150294173 17:63998898-63998920 TCCCCCTGACACCCCTGTCCCGG - Intronic
1150304823 17:64075683-64075705 CCCCTCAAGGTCTCCTGTCCAGG + Intronic
1150426111 17:65078362-65078384 GCCCTCTCCCTCCCCTGTCCAGG - Intergenic
1151147877 17:72058194-72058216 TCTCTTTCGGTCCCCTGTACAGG + Intergenic
1151361820 17:73593525-73593547 TGCCTCTGGGTCTATTGTCCTGG - Intronic
1151715404 17:75828666-75828688 TCCCACTGGCTCCCGTCTCCAGG + Intronic
1152176916 17:78793891-78793913 TCTCCCTGGGTTCCCTGTACTGG + Intronic
1152352231 17:79790359-79790381 GCCCTCTGGGGCTCCTGTGCTGG - Intergenic
1152581658 17:81168031-81168053 CCACTCTGGGTCCCCTGTCAGGG + Intergenic
1152603322 17:81276465-81276487 TACCTCTGCCTCCCCGGTCCTGG + Intronic
1152748638 17:82052467-82052489 TCGCTCGGGGGTCCCTGTCCTGG - Intronic
1152783379 17:82236244-82236266 TCACACCGGGCCCCCTGTCCGGG + Intronic
1153576099 18:6523360-6523382 GCCATCTGAGTTCCCTGTCCTGG + Intronic
1154168568 18:12034614-12034636 TGACTCTGGGTCCTCTGTCCTGG - Intergenic
1155083037 18:22429452-22429474 GCCCTCTGGAGACCCTGTCCAGG - Intergenic
1155654446 18:28177522-28177544 TTCCTCCGGGTCCCCGCTCCAGG + Intergenic
1156458189 18:37306456-37306478 CCATTCTGTGTCCCCTGTCCTGG - Intronic
1157076854 18:44476078-44476100 TCCCTCTTGGTCCCCCATCCAGG + Intergenic
1157385213 18:47254501-47254523 TTCCTCTGGGTCCCGCGTCTGGG - Intergenic
1157556411 18:48615762-48615784 TGCCCCGGGGTCTCCTGTCCAGG - Intronic
1157672261 18:49540488-49540510 TCCTGCTCGGTCCCCTGCCCTGG + Intergenic
1159559978 18:69983703-69983725 TGGCTCTGCATCCCCTGTCCTGG - Intergenic
1159957598 18:74530668-74530690 GCCCTCTGGGAGCCCTGTCCGGG - Intergenic
1160444164 18:78914285-78914307 TCCACCTGGCTTCCCTGTCCCGG + Intergenic
1160632710 18:80257995-80258017 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1160786229 19:901265-901287 TCCTTCGGGGTCCCCAGACCAGG - Intronic
1161699944 19:5789047-5789069 TCCCTCTCTGTGCTCTGTCCTGG - Intronic
1161731063 19:5960891-5960913 TCCAGCTGGGTCACATGTCCAGG - Intronic
1162036588 19:7943438-7943460 ACGCTCTGTGCCCCCTGTCCTGG + Intronic
1162729909 19:12712190-12712212 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1163157991 19:15449566-15449588 TCCCGCGGGGTCTCCTGCCCCGG - Intronic
1163471392 19:17499230-17499252 ACCCTCTGGTGGCCCTGTCCGGG + Intronic
1163817637 19:19476636-19476658 TCCCTCATGGTCCCCTAACCTGG + Intronic
1164083545 19:21880964-21880986 GCCCTCTGGTGGCCCTGTCCAGG + Intergenic
1164084705 19:21890234-21890256 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1164955227 19:32377305-32377327 GCCCTCTGGTGGCCCTGTCCAGG + Intronic
1165468579 19:35989831-35989853 TGCCTCTGGATACCGTGTCCTGG + Intergenic
1165541234 19:36493301-36493323 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1165821398 19:38678634-38678656 TCGCCCTGGGTCCCATGGCCCGG - Intronic
1165991548 19:39818105-39818127 CCCCTGTGGCTCCCCTATCCTGG + Intergenic
1166332881 19:42088862-42088884 GGCCTCTGGGTGCCTTGTCCGGG - Intronic
1166533264 19:43554978-43555000 TCCCTCTGGGGCCTGTGTCAGGG - Intronic
1167314394 19:48755332-48755354 TCCCTCTGGGTGCCCACTCCAGG + Exonic
1167370000 19:49075022-49075044 GCCCTCTGGTGGCCCTGTCCAGG - Intergenic
1167392929 19:49208466-49208488 GCCCTCTGGTGGCCCTGTCCAGG + Intronic
1167576560 19:50320536-50320558 TCCCTCTCTCTCCCCTGCCCAGG - Intronic
1167645533 19:50703272-50703294 TCTGCCTGGGGCCCCTGTCCTGG + Intronic
1167991030 19:53360711-53360733 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1168131545 19:54323079-54323101 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1168215175 19:54919855-54919877 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1168313424 19:55473126-55473148 GCCCCCTGGGTCCCCTGTTCCGG + Intergenic
925021811 2:575561-575583 ACCCTGTGTGTCCCATGTCCAGG - Intergenic
925845133 2:8027874-8027896 GTCCTCTGGGTTCCCTGGCCGGG + Intergenic
925939949 2:8807665-8807687 TCCATCTGGGAAGCCTGTCCAGG - Intronic
925976635 2:9146499-9146521 TCCCCCTGGATTTCCTGTCCTGG + Intergenic
927669291 2:25055361-25055383 TCCCTATGGGTCCCCAGTGAGGG - Intronic
929454670 2:42057386-42057408 TCCCACTGGCTCACCTGTCCAGG - Exonic
929601346 2:43206616-43206638 TCCCTCTGGCTCCCCTTCACTGG - Intergenic
930585953 2:53267576-53267598 TCCCCCTGGGAACTCTGTCCCGG - Intergenic
932402156 2:71488480-71488502 TGCATCTGGGCCCCCTGTCTTGG - Intronic
932459879 2:71875347-71875369 TCCAACTGGGGCCCCTTTCCTGG + Intergenic
932672942 2:73754042-73754064 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
934543138 2:95193069-95193091 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
934555335 2:95284144-95284166 GCCCTCAGGGCCCCCTGCCCTGG - Intronic
934663572 2:96155547-96155569 ACCCTCTGGGTCTCCAGCCCAGG - Intergenic
934709951 2:96508279-96508301 TCCCTCTGGGGCGCCCCTCCCGG - Intergenic
934757060 2:96831851-96831873 TCCCTCAGCTTCCCCTGCCCGGG + Intronic
934921522 2:98348055-98348077 CCCATCTGGGTCCTCTGACCTGG - Intronic
936075647 2:109399986-109400008 TCCCTCTGGCTGCCCTGGACAGG + Intronic
936583897 2:113734384-113734406 TCCCTCTGGTTACCCTACCCAGG + Intronic
937016926 2:118614668-118614690 TCCCTCTAGGTCCTCTGCCTGGG - Intergenic
938313586 2:130311275-130311297 TCCCTCTGGATTCCCTGTATAGG + Intergenic
938384419 2:130854258-130854280 ACAGTCTGGGACCCCTGTCCTGG + Intronic
938713029 2:133991888-133991910 TCTCTCCAGGTCCCCTTTCCTGG - Intergenic
939345772 2:140964538-140964560 GCCCTCTGGTGGCCCTGTCCAGG + Intronic
941175434 2:162192436-162192458 TCCTTCTTGGTCTCCTCTCCAGG + Intronic
942448982 2:176097594-176097616 TCCCTCTGGCTCCGCTGTCAGGG + Intergenic
943372999 2:187039684-187039706 TGTCTCTGGGTTCCCGGTCCTGG - Intergenic
946434786 2:219644302-219644324 TCCCTCTGGGTCTCCATCCCTGG - Intergenic
947606644 2:231490227-231490249 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
948013810 2:234671638-234671660 TCCCTCTATGTCCCTTGTCTGGG + Intergenic
948456001 2:238104913-238104935 TCCCTCTGGAGCCCCCATCCAGG - Intronic
948813078 2:240495108-240495130 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
948836753 2:240629594-240629616 GCCCTTTGGGCTCCCTGTCCAGG + Intronic
948895650 2:240925702-240925724 GCCCTGTGGGTTCTCTGTCCAGG + Exonic
949046777 2:241875987-241876009 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
949054881 2:241922209-241922231 TACCTCCCGGTCTCCTGTCCTGG - Intergenic
1170508554 20:17054205-17054227 CCCCTCTGGGAGCTCTGTCCAGG + Intergenic
1171159561 20:22908974-22908996 TTCCCCTGGTTCCCCAGTCCTGG - Intergenic
1171164621 20:22958981-22959003 TCCCTCTGTGCCTCCTTTCCAGG + Intergenic
1172109082 20:32535005-32535027 TCCCTGTGGGGCCCCTTTGCAGG - Intronic
1172307205 20:33889166-33889188 TTCCTCTGGGCCCCCTTGCCTGG + Intergenic
1172358852 20:34298456-34298478 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1172481996 20:35276837-35276859 CCCCTCTGTCTGCCCTGTCCTGG - Exonic
1173087457 20:39937500-39937522 TCCCTGGGGATCCCCTCTCCAGG + Intergenic
1173142612 20:40497407-40497429 TCGCTCTTGGTCCCCTTTACAGG - Intergenic
1173626746 20:44478448-44478470 TCCCTCTAGATCCACTATCCAGG - Intronic
1173747885 20:45452024-45452046 TTCCTCTGTCTCCCCTGTTCTGG - Intergenic
1173876563 20:46376014-46376036 TCACTCTGCTTCCCCTGCCCAGG - Intronic
1174334098 20:49845570-49845592 TCCCTCTCGGTGCCCTCCCCTGG + Intronic
1174559234 20:51418067-51418089 TGACCCTGGGGCCCCTGTCCTGG + Intronic
1175930459 20:62491502-62491524 GCTCTCTGGGGCCACTGTCCTGG - Intergenic
1176007389 20:62873823-62873845 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1176115623 20:63430777-63430799 TGCCTCAGGGTCTCCTGCCCTGG - Intronic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1176154913 20:63614378-63614400 GCCCTCTGGTGGCCCTGTCCAGG - Intronic
1176260403 20:64176549-64176571 CCACTCTGGGTTCCTTGTCCTGG + Intronic
1176420360 21:6509067-6509089 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1176667217 21:9698871-9698893 GCCCACTGGGTCCCCTGGGCAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179695851 21:43117387-43117409 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1179916208 21:44479810-44479832 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1180874836 22:19170315-19170337 TCCCTTTGGGGTCCCTGTCCAGG + Intergenic
1181224170 22:21381373-21381395 TCCCTGTGGCTACCATGTCCAGG + Intergenic
1181254462 22:21553450-21553472 TCCCTGTGGCTACCATGTCCAGG - Intronic
1181415742 22:22757572-22757594 TTCCTCTGTGTCCCCTGGCTGGG - Intronic
1181535089 22:23537674-23537696 TCCCGCTGGGTCCCGGGTGCTGG - Intergenic
1181598006 22:23930194-23930216 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1181729946 22:24837709-24837731 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1181745583 22:24953133-24953155 TCCCACTGGATCCCCAGTCAGGG + Intronic
1183002034 22:34868584-34868606 TCCCTCTGCTTCACCTGTGCTGG + Intergenic
1183835140 22:40446399-40446421 TCGCCCTGGATCACCTGTCCAGG - Intronic
1184133634 22:42533055-42533077 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1184344475 22:43904619-43904641 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1184516355 22:44965164-44965186 TCCCCCTGTGCCACCTGTCCAGG + Intronic
1184616537 22:45641649-45641671 TCCCTCTGTGTCCCAAGCCCAGG - Intergenic
1184691720 22:46120279-46120301 TCGCTCTGGGCTCCCTGCCCTGG - Intergenic
1184789006 22:46687751-46687773 TCCCTGGAGGTCCCCTGCCCAGG + Intronic
1185035623 22:48475191-48475213 TCCCTCTGTGTGCCATGGCCTGG + Intergenic
1185073498 22:48669967-48669989 CCTCTCCGGGTCCCCAGTCCTGG + Intronic
1185336594 22:50273497-50273519 ACCCTCTGGTGGCCCTGTCCGGG - Intergenic
950022048 3:9794002-9794024 TCCTCCTGGGTTCCCTATCCTGG + Intronic
950716169 3:14849176-14849198 TCCCTCTGCGTCCCCCATCCAGG + Intronic
952574635 3:34759618-34759640 TTCCTCTGGGAGCTCTGTCCTGG - Intergenic
953026133 3:39146315-39146337 TCACTCAGTGTCCACTGTCCAGG - Intronic
953171798 3:40513904-40513926 GCCCTCTGGTGGCCCTGTCCCGG - Intronic
953294111 3:41695963-41695985 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
953682577 3:45051002-45051024 TCCCTCTGAGTCAGCTCTCCAGG - Intergenic
954465606 3:50652842-50652864 CCTCTCTGTGTCCCCTGACCAGG + Intergenic
954632632 3:52055646-52055668 TCCCTCTGCGCCCCCTTTCTCGG - Intronic
954653793 3:52181678-52181700 GGCCCCTGAGTCCCCTGTCCTGG - Intergenic
955350593 3:58190408-58190430 TCCCTTTGGGTCACCTGGCCTGG - Intergenic
955406772 3:58630688-58630710 TCCCAGTGTGTCCCCTGCCCTGG + Intergenic
956516045 3:70049316-70049338 TTCCTCTGGGTAGCCTTTCCTGG - Intergenic
961531580 3:127543559-127543581 TGCCTCATGGTCCCCTCTCCTGG - Intergenic
961535874 3:127570200-127570222 TTCCTCTGAGGCCCCTCTCCTGG - Intergenic
962221769 3:133570465-133570487 TCCCTCTGGGTCCTCTGAAGTGG - Intergenic
962604647 3:137023452-137023474 TCCCTCTGGGAGCCCTTGCCTGG - Intergenic
963282361 3:143397244-143397266 TCACTCTGGGTGCCCTGCCTGGG + Intronic
963754023 3:149214504-149214526 TCCCTGTCCATCCCCTGTCCTGG + Intronic
964414345 3:156431772-156431794 CCCATATGGGTCCACTGTCCAGG - Intronic
965439833 3:168699095-168699117 TCCCTCTGGTGGCCCTGTCTGGG + Intergenic
966806242 3:183810016-183810038 TACCTCTGTGCTCCCTGTCCTGG + Intronic
966865273 3:184255406-184255428 TGCCTCTGGGTACATTGTCCAGG + Intronic
968121312 3:196127989-196128011 TCCCTCTGCCTGCCCTGTCCTGG - Intergenic
968271796 3:197408663-197408685 TCCCTGCGGGTCTCCTCTCCGGG + Intergenic
968350872 3:198050958-198050980 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
969115516 4:4868527-4868549 TCCCCCTGGGTCCCCTCCTCTGG + Intergenic
969629929 4:8330111-8330133 TCCCTCTCAGTCCCCTGGGCAGG - Intergenic
969995078 4:11303611-11303633 TCCCTCTCAGTCTCCTGGCCTGG + Intergenic
971261948 4:25065390-25065412 TCCTTCTGGGGACACTGTCCTGG - Intergenic
971913084 4:32821972-32821994 TCCCTCTGTCTCTCCAGTCCAGG + Intergenic
972384040 4:38546446-38546468 TACTTCTGGGTCCCATTTCCAGG - Intergenic
972735891 4:41840922-41840944 TCTATCTGCCTCCCCTGTCCAGG + Intergenic
973366294 4:49211977-49211999 TCTCTCTGGGAGCTCTGTCCCGG + Intergenic
976556841 4:86460388-86460410 TCCCTCTGGGTCTCCTGTAAAGG - Intronic
977039878 4:92002438-92002460 TTCCTCTGGGAGCTCTGTCCCGG - Intergenic
977394110 4:96450547-96450569 TACCTCTGGGGGCTCTGTCCAGG + Intergenic
979914648 4:126415027-126415049 ACCCTCTGCTTCACCTGTCCTGG + Intergenic
984650049 4:182261424-182261446 TTCCTGTGTGTCCCCTGACCTGG - Intronic
985091063 4:186363190-186363212 GCCCTCTGGTGGCCCTGTCCAGG - Intergenic
985172361 4:187165219-187165241 TCAGGCTGGGTCCCCTGTCAGGG - Intergenic
985407791 4:189653463-189653485 GCCCACTGGGTCCCCTGGGCAGG + Intergenic
985613349 5:903272-903294 GCCCTCTGGTGGCCCTGTCCAGG + Intronic
985875452 5:2590969-2590991 TCTCTGTGGTTCCCGTGTCCTGG + Intergenic
986164570 5:5262927-5262949 ACTCTCTAGGTCCCTTGTCCAGG - Intronic
986310095 5:6545136-6545158 CCCCACTGGGTCCCCTGCACAGG + Intergenic
987271581 5:16314729-16314751 TCCCACTCCATCCCCTGTCCAGG + Intergenic
989239318 5:39185970-39185992 TCCCGCTGGCTGCCTTGTCCAGG + Intronic
991143448 5:63273744-63273766 TCCCTCTGGGAACTCTGTCCAGG + Intergenic
991642968 5:68772917-68772939 TCCCGCTGTGCCCGCTGTCCTGG + Intergenic
994346764 5:98696719-98696741 TCCCTCTGGGAACTCTGTCCTGG + Intergenic
994516117 5:100774931-100774953 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
995223147 5:109673767-109673789 TCTCTTTGTGTCACCTGTCCAGG + Intergenic
997972016 5:138411205-138411227 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
998539370 5:142965468-142965490 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
999216099 5:149936584-149936606 TCCCACTGGGTACTCAGTCCTGG + Intronic
1001568463 5:172715218-172715240 TCCCTCTGGGCCGGCTGTCCAGG - Intergenic
1001633225 5:173192074-173192096 TCCCTCTGTGTCCCTTGTAAGGG + Intergenic
1002205739 5:177561425-177561447 GCCCTCTGGTGGCCCTGTCCAGG - Intergenic
1002299958 5:178252431-178252453 TCCCTCCGGGTGTCCTGGCCTGG - Intronic
1002317035 5:178350025-178350047 GCCCTCTGTGCCCCCTCTCCAGG + Intronic
1002526845 5:179819890-179819912 TCCCTCTGGGTTTCCTCCCCTGG + Intronic
1002637160 5:180614174-180614196 TCCCTCTGTCTCCCCAGGCCCGG - Exonic
1006220114 6:32482572-32482594 TCCCTCTCAGTCCCCTTTGCTGG + Intergenic
1006229413 6:32570325-32570347 TCCCTCTCAGTCCCCTTTGCTGG + Intronic
1006433713 6:34014905-34014927 TCCCTCTGGGGCTCCAGGCCTGG - Intergenic
1006794262 6:36721932-36721954 GCCCTCTGGGTCCCCAGTCTTGG - Exonic
1007483060 6:42162729-42162751 GCCATCAGGGTCCCCTGACCTGG - Intronic
1007768513 6:44175993-44176015 TTCCTTTGGGTGCCCAGTCCAGG + Intronic
1009260406 6:61479283-61479305 TCCCTCTGCTGGCCCTGTCCGGG - Intergenic
1009325736 6:62345927-62345949 TCCCTCTGGGAGCTCTGTCTGGG - Intergenic
1009596647 6:65745263-65745285 TCCCTCTGGGAGCTCTGCCCAGG - Intergenic
1010229458 6:73521661-73521683 CCCCTCGGGGTCCCCGGGCCTGG - Intronic
1010765141 6:79770241-79770263 TCCCTCTGAGGCTGCTGTCCAGG - Intergenic
1012616323 6:101283565-101283587 TCCCTCTGGGAGCTCTGTCTTGG - Intergenic
1013616122 6:111845081-111845103 TTCATCTGGGTTCCCAGTCCTGG - Intronic
1013932056 6:115545751-115545773 TTCCTCTGGGATCTCTGTCCCGG - Intergenic
1019340641 7:507332-507354 TCCCTCTGGGTCTCATCTGCCGG - Intronic
1019352091 7:559153-559175 CCCCTCTGGGTGCCGAGTCCTGG - Intronic
1019363408 7:617689-617711 TCCATCTGTTTCCCCCGTCCTGG + Intronic
1019528101 7:1489841-1489863 TGGCTCTGGGCTCCCTGTCCAGG + Intronic
1019756659 7:2775857-2775879 TGCCCCTGGGTAACCTGTCCAGG - Intronic
1022018096 7:26370393-26370415 TCCCTCTGTGTCCTCCGCCCTGG - Intronic
1022197284 7:28081377-28081399 TCCCTCTTGCTCCCCTCTGCAGG - Intronic
1022335400 7:29417099-29417121 TCCTTCTGGCTCCCCTGCCAGGG + Intronic
1022411503 7:30141922-30141944 TCCCTCTGGGGCCCTTGCTCTGG - Intronic
1022465961 7:30653390-30653412 TTCCTCTGGGTTCTCTGTGCTGG - Exonic
1022705727 7:32800622-32800644 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1023827669 7:44020352-44020374 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1023835313 7:44064311-44064333 TCCCTCTGGAGCCCCTCTCTGGG - Intronic
1023983238 7:45081565-45081587 TCCCTCTGGGACCTCAGGCCTGG - Intronic
1025022395 7:55489873-55489895 TCTCCCTGGGTCCCCTGCCAGGG - Intronic
1025092154 7:56073154-56073176 TCCCACAGGATTCCCTGTCCAGG - Intronic
1025872416 7:65447301-65447323 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1026376082 7:69752330-69752352 TCTCTCTGGGCCCCTTGTCATGG + Intronic
1026847289 7:73705293-73705315 TCCCACTGGGCCCCCTGGGCTGG - Intronic
1027056061 7:75050353-75050375 TCCATCTGGGTCACTTGCCCTGG - Intronic
1027188087 7:75983668-75983690 TCACTCTGGGCCTCCTGACCTGG + Intronic
1028177047 7:87671859-87671881 TCCCCCTGGGAGCACTGTCCTGG + Intronic
1029277494 7:99415715-99415737 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1029488772 7:100859028-100859050 TCCCTCTGCTCCCCCTCTCCAGG + Exonic
1029650485 7:101887925-101887947 TCCCTCTGCGTGCCCACTCCAGG + Intronic
1029690710 7:102179516-102179538 TCCCTCAGTGGCCCCTGTCCAGG + Intronic
1029738845 7:102480120-102480142 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1029755971 7:102573776-102573798 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1029773912 7:102672848-102672870 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1030375107 7:108745346-108745368 TCCCACTGGGAGCTCTGTCCAGG + Intergenic
1030656494 7:112173930-112173952 TCCTTGTGGGTCACCTGCCCAGG - Intronic
1032016002 7:128380837-128380859 TCCCTCTGGAGCCCCAGTACAGG + Intergenic
1033785631 7:144727006-144727028 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1034498535 7:151435899-151435921 TCCCTCTAGGGCCTCAGTCCAGG - Intronic
1034752518 7:153584089-153584111 TTCCTCTGGGTCCCAGGTCCTGG - Intergenic
1034787614 7:153939814-153939836 TCCATCTGGTTCCTCTTTCCAGG - Intronic
1034983705 7:155494689-155494711 TCCGTCCAGGTTCCCTGTCCTGG + Intronic
1034983725 7:155494761-155494783 TCCGTCCAGGTTCCCTGTCCTGG + Intronic
1035099697 7:156386353-156386375 TGCCTCTGAGCCCCCTGTGCAGG - Intergenic
1035593926 8:839663-839685 TCCCTCTGTGTGCCTCGTCCTGG + Intergenic
1035756192 8:2034715-2034737 GCCCTCTGGGTCCCGTTTCCTGG + Intergenic
1039385492 8:37131903-37131925 TCCATCTGGCTCTCCTGTGCAGG - Intergenic
1039469280 8:37803428-37803450 TCCTTCTGGTCCCCCAGTCCCGG - Intronic
1046067451 8:109213686-109213708 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1048301715 8:133256045-133256067 TGCCCCTGGGGCTCCTGTCCAGG - Intronic
1049204972 8:141359432-141359454 TGCCTCTGGGACCCCAGCCCTGG + Intronic
1049268647 8:141682699-141682721 TCCCTCTGGGCCTCCTGAACCGG - Intergenic
1049458786 8:142710471-142710493 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1049516280 8:143058831-143058853 GCCCTCTGGTGGCCCTGTCCGGG + Intronic
1049543039 8:143217116-143217138 TACCTCAGGGTCCCCTTACCTGG + Intergenic
1049597794 8:143492698-143492720 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049597821 8:143492768-143492790 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049597835 8:143492803-143492825 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049597849 8:143492838-143492860 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049597928 8:143493048-143493070 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049597966 8:143493153-143493175 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049597980 8:143493188-143493210 CTCCTCAGGGTCCCGTGTCCTGG + Intronic
1049775270 8:144401104-144401126 TCCCTCGGGGTCTCCTATGCTGG - Intronic
1049879996 8:145055414-145055436 GCCCTCTGGTGGCCCTGTCCGGG - Exonic
1052718683 9:32148709-32148731 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1053434296 9:38065354-38065376 TCCCTCTGGGTCTTCTGGTCAGG - Intronic
1055476207 9:76666126-76666148 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1057312199 9:93949533-93949555 TGCCTCTGCGTTCCCTGTCCCGG + Intergenic
1057520189 9:95753810-95753832 TCCCTCTGGCTTCCGTCTCCTGG + Intergenic
1058159473 9:101552253-101552275 TCCCTCTGGTTACCTTGTTCAGG - Exonic
1060276827 9:122188846-122188868 TCCCTGTGTGCCTCCTGTCCGGG + Intronic
1060401660 9:123353232-123353254 TCCCACTGGCTCACCTTTCCAGG + Intergenic
1060820838 9:126660906-126660928 TGCCTGTGGGTCCCCTATCATGG - Intronic
1060949179 9:127590090-127590112 TCCCGCTGGGTCCGTTTTCCAGG + Intergenic
1060988703 9:127836150-127836172 TGCCTCTGGGGCCCCCGGCCGGG - Intronic
1061245485 9:129399369-129399391 TCCCGCTGGGTCCCGGGTGCTGG + Intergenic
1061334141 9:129919072-129919094 TGCCTCTGGGTCCCCAGTCTTGG + Intronic
1061336729 9:129943048-129943070 TCCCACAGAGTCCCCTGTCCTGG + Intronic
1061463962 9:130763137-130763159 TCTTTCTGGTTCCCCTGCCCTGG + Intronic
1061474504 9:130855130-130855152 GACCTCTGGTTCCCCTGCCCTGG - Intronic
1061835913 9:133329528-133329550 GCCCTCTGGTGGCCCTGTCCGGG + Intergenic
1062278805 9:135742958-135742980 TGCCTCTGGGTCCCAGGTGCTGG + Intronic
1062508437 9:136890753-136890775 GACCTCAGGGTCCCCTGACCGGG + Intronic
1062520155 9:136954436-136954458 CCGCCCCGGGTCCCCTGTCCTGG + Intronic
1062520250 9:136954647-136954669 TCCCTCTGGGTCCCCTGTCCTGG + Intronic
1062531724 9:137004435-137004457 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1062557169 9:137118842-137118864 GCCCTCTGGTGGCCCTGTCCTGG - Intergenic
1062588517 9:137262382-137262404 GCCCTCTGGTGGCCCTGTCCAGG + Intronic
1062639319 9:137510051-137510073 GCCCTCTGGTGGCCCTGTCCAGG - Intronic
1062645453 9:137545788-137545810 GCCCTCTGGTGGCCCTGTCCGGG - Intronic
1062647931 9:137559268-137559290 GCCCTCTGGTGGCCCTGTCCAGG - Intronic
1203488153 Un_GL000224v1:77635-77657 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1203500774 Un_KI270741v1:19531-19553 GCCCTCTGGTGGCCCTGTCCGGG - Intergenic
1203658880 Un_KI270753v1:22889-22911 GCCCACTGGGTCCCCTGGGCAGG + Intergenic
1188212568 X:27442590-27442612 GCCCTCTGGTGGCCCTGTCCAGG + Intergenic
1189363303 X:40369656-40369678 TCCCACTGGGAACCCTTTCCTGG - Intergenic
1190687665 X:52888886-52888908 GGCCTCTGTGTTCCCTGTCCCGG + Intergenic
1190698317 X:52966906-52966928 GGCCTCTGTGTTCCCTGTCCCGG - Intronic
1192197150 X:69036158-69036180 TTCTTCTGAGTCCCCTTTCCTGG + Intergenic
1192760344 X:74089263-74089285 TGCCTCTGGGACTCCTCTCCAGG - Intergenic
1194445417 X:93981606-93981628 CCCCTTTGGGTCCCCTCCCCTGG - Intergenic
1195105724 X:101600096-101600118 TGGCTCTGGGAGCCCTGTCCCGG + Intergenic
1195107159 X:101613671-101613693 TGGCTCTGGGAGCCCTGTCCCGG - Intergenic
1196752177 X:119127952-119127974 TCCTTCTGGGTCGCCTTTGCTGG + Intronic
1197400334 X:125981501-125981523 TCACTCTGGGAACTCTGTCCTGG - Intergenic
1197402249 X:126006314-126006336 TCCCACTGGGAGCTCTGTCCAGG - Intergenic
1201267041 Y:12217243-12217265 TGCCTGTGTGTCCCCTGTGCTGG + Intergenic