ID: 1062521111

View in Genome Browser
Species Human (GRCh38)
Location 9:136958395-136958417
Sequence CTGCCTTGGGGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062521111_1062521124 20 Left 1062521111 9:136958395-136958417 CCAGCTTCCCTCCCCCAAGGCAG No data
Right 1062521124 9:136958438-136958460 AGATCATGACCACCATGTGCTGG No data
1062521111_1062521125 23 Left 1062521111 9:136958395-136958417 CCAGCTTCCCTCCCCCAAGGCAG No data
Right 1062521125 9:136958441-136958463 TCATGACCACCATGTGCTGGTGG No data
1062521111_1062521120 -8 Left 1062521111 9:136958395-136958417 CCAGCTTCCCTCCCCCAAGGCAG No data
Right 1062521120 9:136958410-136958432 CAAGGCAGGGAACATAACCCCGG No data
1062521111_1062521126 24 Left 1062521111 9:136958395-136958417 CCAGCTTCCCTCCCCCAAGGCAG No data
Right 1062521126 9:136958442-136958464 CATGACCACCATGTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062521111 Original CRISPR CTGCCTTGGGGGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr