ID: 1062521144

View in Genome Browser
Species Human (GRCh38)
Location 9:136958515-136958537
Sequence CTCTGCTTGTGCCTTTGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062521144_1062521147 -5 Left 1062521144 9:136958515-136958537 CCCGGACAAAGGCACAAGCAGAG No data
Right 1062521147 9:136958533-136958555 CAGAGACTAAGACTCCCTGGCGG No data
1062521144_1062521151 16 Left 1062521144 9:136958515-136958537 CCCGGACAAAGGCACAAGCAGAG No data
Right 1062521151 9:136958554-136958576 GGTGCCCTCCTCCTCCCTGGCGG No data
1062521144_1062521150 13 Left 1062521144 9:136958515-136958537 CCCGGACAAAGGCACAAGCAGAG No data
Right 1062521150 9:136958551-136958573 GGCGGTGCCCTCCTCCTCCCTGG No data
1062521144_1062521146 -8 Left 1062521144 9:136958515-136958537 CCCGGACAAAGGCACAAGCAGAG No data
Right 1062521146 9:136958530-136958552 AAGCAGAGACTAAGACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062521144 Original CRISPR CTCTGCTTGTGCCTTTGTCC GGG (reversed) Intergenic
No off target data available for this crispr