ID: 1062521963

View in Genome Browser
Species Human (GRCh38)
Location 9:136961667-136961689
Sequence TGTTTTCTGCAGGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062521958_1062521963 5 Left 1062521958 9:136961639-136961661 CCTGGGGCTTTCCAGCGCTGCCT No data
Right 1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG No data
1062521956_1062521963 18 Left 1062521956 9:136961626-136961648 CCAGGACCAGCTGCCTGGGGCTT No data
Right 1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG No data
1062521957_1062521963 12 Left 1062521957 9:136961632-136961654 CCAGCTGCCTGGGGCTTTCCAGC No data
Right 1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG No data
1062521959_1062521963 -6 Left 1062521959 9:136961650-136961672 CCAGCGCTGCCTCTGCATGTTTT No data
Right 1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG No data
1062521952_1062521963 27 Left 1062521952 9:136961617-136961639 CCTGCTGGGCCAGGACCAGCTGC No data
Right 1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062521963 Original CRISPR TGTTTTCTGCAGGAGGAAGA AGG Intergenic
No off target data available for this crispr