ID: 1062523254

View in Genome Browser
Species Human (GRCh38)
Location 9:136968325-136968347
Sequence GCACATGGCCGGGGGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062523239_1062523254 30 Left 1062523239 9:136968272-136968294 CCCCATCTGTGACCTCTTTGCCA No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data
1062523241_1062523254 28 Left 1062523241 9:136968274-136968296 CCATCTGTGACCTCTTTGCCACG No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data
1062523242_1062523254 18 Left 1062523242 9:136968284-136968306 CCTCTTTGCCACGCCTCTAATAC No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data
1062523247_1062523254 -4 Left 1062523247 9:136968306-136968328 CCGCTCGCTTGCTCAGAGGGCAC No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data
1062523243_1062523254 10 Left 1062523243 9:136968292-136968314 CCACGCCTCTAATACCGCTCGCT No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data
1062523244_1062523254 5 Left 1062523244 9:136968297-136968319 CCTCTAATACCGCTCGCTTGCTC No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data
1062523240_1062523254 29 Left 1062523240 9:136968273-136968295 CCCATCTGTGACCTCTTTGCCAC No data
Right 1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062523254 Original CRISPR GCACATGGCCGGGGGGTCCT TGG Intergenic