ID: 1062524862

View in Genome Browser
Species Human (GRCh38)
Location 9:136974093-136974115
Sequence GCCGTCCCCGGCTGCTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062524855_1062524862 -10 Left 1062524855 9:136974080-136974102 CCCTGTCCTCTGCGCCGTCCCCG No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data
1062524850_1062524862 16 Left 1062524850 9:136974054-136974076 CCTATCCTCTGGCTTGTCCCGGG No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data
1062524848_1062524862 17 Left 1062524848 9:136974053-136974075 CCCTATCCTCTGGCTTGTCCCGG No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data
1062524852_1062524862 11 Left 1062524852 9:136974059-136974081 CCTCTGGCTTGTCCCGGGCTGCC No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data
1062524854_1062524862 -2 Left 1062524854 9:136974072-136974094 CCGGGCTGCCCTGTCCTCTGCGC No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data
1062524847_1062524862 18 Left 1062524847 9:136974052-136974074 CCCCTATCCTCTGGCTTGTCCCG No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data
1062524853_1062524862 -1 Left 1062524853 9:136974071-136974093 CCCGGGCTGCCCTGTCCTCTGCG No data
Right 1062524862 9:136974093-136974115 GCCGTCCCCGGCTGCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062524862 Original CRISPR GCCGTCCCCGGCTGCTGGGC GGG Intergenic