ID: 1062525132

View in Genome Browser
Species Human (GRCh38)
Location 9:136975170-136975192
Sequence CCGGCTAGGACTGTGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062525132_1062525145 7 Left 1062525132 9:136975170-136975192 CCACCTTGCACAGTCCTAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1062525145 9:136975200-136975222 GGGGAGAAATCTGGCGTGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 112
1062525132_1062525146 13 Left 1062525132 9:136975170-136975192 CCACCTTGCACAGTCCTAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1062525146 9:136975206-136975228 AAATCTGGCGTGCCAGGAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1062525132_1062525144 -2 Left 1062525132 9:136975170-136975192 CCACCTTGCACAGTCCTAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1062525144 9:136975191-136975213 GGGGGAGGAGGGGAGAAATCTGG 0: 1
1: 0
2: 8
3: 110
4: 1098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062525132 Original CRISPR CCGGCTAGGACTGTGCAAGG TGG (reversed) Intergenic
900390611 1:2432321-2432343 CCGGCTGGGACTGGGGCAGGTGG + Intronic
902617172 1:17630127-17630149 CTGGCCAGGACTGTCCAGGGAGG - Intronic
903506328 1:23838206-23838228 TTGGCTGGGACTGTGGAAGGGGG + Intronic
904524045 1:31119155-31119177 CCAGCTTGGGCTGGGCAAGGTGG + Intergenic
904703395 1:32372603-32372625 CAGGGTAGGACGGTGGAAGGAGG - Intronic
905017382 1:34786950-34786972 GATGCTGGGACTGTGCAAGGAGG + Intronic
908095054 1:60729026-60729048 ACAGCTAGGGCTGGGCAAGGTGG - Intergenic
918394096 1:184096306-184096328 GAGGCTAGGACTGTGCACTGAGG + Intergenic
920092819 1:203466160-203466182 AAGGCTAGGGCTGTGCACGGGGG + Intergenic
921053550 1:211527555-211527577 CCTGCTAGGACTCTACTAGGAGG - Intergenic
922563796 1:226588150-226588172 CCAGCAAGGAATTTGCAAGGAGG - Intronic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1074114909 10:110448689-110448711 TGGGGTGGGACTGTGCAAGGTGG + Intergenic
1076677964 10:132157608-132157630 CCTGCTAGGACTGCACCAGGCGG - Intronic
1083386151 11:62311804-62311826 CCGGCTGGTACTGTAGAAGGAGG + Intergenic
1084600571 11:70143056-70143078 CCTGCTTGGACTGTGCATGTGGG - Intronic
1089155223 11:116396831-116396853 CCAGCTAGGTCTGTGCAAATGGG - Intergenic
1090178592 11:124673728-124673750 CCGCCTAGGACTGGGAAAGTGGG + Exonic
1093696537 12:22166846-22166868 CAGGTTAGGACTCTTCAAGGAGG + Intronic
1102071101 12:110020545-110020567 CTGGCCAGGCCAGTGCAAGGAGG - Intronic
1107652852 13:42561952-42561974 CAGGCCAGGACTGAGCATGGTGG - Intergenic
1111291291 13:86173538-86173560 TCAGCAAGGATTGTGCAAGGGGG - Intergenic
1115684325 14:35779236-35779258 CAGGCTTGGGCTGGGCAAGGTGG + Intronic
1117735374 14:58763580-58763602 CCGGTTAGGACTGCACCAGGTGG + Intergenic
1122535253 14:102457455-102457477 CCGTGTATGACTGTGCATGGCGG + Intronic
1124829648 15:33135644-33135666 CTGGCAAGGACTGTGTAAGATGG + Intronic
1132685553 16:1160620-1160642 CCCGCGAGGAGTGTGCACGGAGG - Intronic
1134682521 16:16136379-16136401 CTGGCCAGGACTGTTGAAGGTGG - Intronic
1143862618 17:9901958-9901980 ATGGCTGGGGCTGTGCAAGGTGG - Intronic
1149575166 17:57706781-57706803 TCGGCTGGGCATGTGCAAGGTGG + Intergenic
1153697893 18:7663125-7663147 CAAGTTAGGACTGTGCAAGCAGG - Intronic
1157948437 18:52007153-52007175 CAGGCTGGGGCTGTGCAAGTAGG - Intergenic
1158023548 18:52870172-52870194 CCTGCAGGGAGTGTGCAAGGAGG - Intronic
1158555745 18:58473269-58473291 GCCCCTAGGATTGTGCAAGGAGG + Intergenic
1159859234 18:73627700-73627722 CCTGCTAGCATTTTGCAAGGGGG + Intergenic
1162478616 19:10915402-10915424 GAGGCCAGGCCTGTGCAAGGAGG + Intronic
1162532782 19:11245537-11245559 CCTGCTGGGGCTGGGCAAGGGGG - Intronic
1164443326 19:28296790-28296812 CCAGCTAAGCCTGTGCATGGAGG + Intergenic
1166804322 19:45476227-45476249 ACGGCTAGGATTTTGCAATGGGG - Intronic
1167505961 19:49871197-49871219 AGGGCTAGGAATGTGCAGGGTGG + Intronic
926139506 2:10359883-10359905 CCGGCGGGCACTGTGGAAGGAGG - Intronic
931309678 2:61066169-61066191 CCGGCTGAGGCTGTGCACGGGGG - Intronic
940992796 2:160114910-160114932 CCGCCTAGCAGTGTACAAGGCGG - Intronic
947564658 2:231186121-231186143 CAGGCTAGGGCTGGGCAGGGAGG - Intergenic
1172042700 20:32057183-32057205 CTGGCAAGGGCTGTGCAAGCTGG - Intronic
1175077898 20:56391626-56391648 CCGGGAAGGCCTCTGCAAGGAGG + Intronic
1175762478 20:61571052-61571074 GGGGCAAGGCCTGTGCAAGGTGG + Intronic
1178845274 21:36169428-36169450 CCACCGAGGCCTGTGCAAGGTGG - Intronic
1183341072 22:37282071-37282093 CCTGCTAGGACTGTCCAAGTTGG + Intronic
1184572685 22:45336334-45336356 CATGCCAGGACTGTGCAAAGAGG + Exonic
1185302157 22:50087524-50087546 CAGGCGAGGACCATGCAAGGGGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
968578995 4:1380985-1381007 CCGGGTAGGTCTGGGCAAGGCGG + Exonic
971004481 4:22357729-22357751 CCGTGAAGGACTGTGCTAGGAGG + Intronic
973094505 4:46179852-46179874 CCTGCTAGGACAGTGCAAAAGGG + Intergenic
982173492 4:152683655-152683677 CCAGCTAGGAAGGTGCAGGGAGG + Intergenic
984109627 4:175596131-175596153 CATGTTAGGACTGTGCAAGAAGG + Intergenic
990343607 5:54849570-54849592 CCGGGAAGGTCTGTTCAAGGTGG - Intergenic
992486369 5:77200989-77201011 GCTGCTAGGGCTGTGAAAGGAGG - Intergenic
992500751 5:77340560-77340582 AAGGGTAGGACTGGGCAAGGCGG - Intronic
997804948 5:136907580-136907602 CAGGCAAGGAGTGAGCAAGGAGG - Intergenic
997861994 5:137426791-137426813 GCGGGTAGGACTGAGCAATGGGG - Intronic
1000977404 5:167780358-167780380 CCAGCTGGGACTGTGCACGTTGG - Intronic
1006044266 6:31281039-31281061 CCACCAAGGCCTGTGCAAGGTGG + Intronic
1007524574 6:42480576-42480598 CCAGCTAGGGCTGTGCATGGTGG - Intergenic
1013213192 6:108004815-108004837 CCACCGAGGCCTGTGCAAGGTGG - Intergenic
1013517680 6:110903350-110903372 CTGGAGAGGACTGAGCAAGGAGG - Intergenic
1016370895 6:143372810-143372832 CCGGCTGGGGCTGAGCAAGCTGG + Intergenic
1018462096 6:164008053-164008075 CTGGCCAGGAATGTGCAGGGTGG - Intergenic
1018716016 6:166533308-166533330 CCAGCCAGGACAGTGCAGGGAGG + Intronic
1019958573 7:4437112-4437134 ACAGCTAGGAATGTGGAAGGAGG - Intergenic
1022512872 7:30952387-30952409 TCTGCTAGGACAGTACAAGGGGG - Intronic
1026877549 7:73888100-73888122 CCGGCTGGGACTGGGCTTGGTGG + Intergenic
1032743209 7:134760263-134760285 GCAGCTAGAACTGTGCAAGCGGG - Intronic
1033720505 7:144054116-144054138 GCTGCTAGGACTGAGAAAGGGGG + Intergenic
1038294329 8:26277142-26277164 CAGCCTAGCACTGTGGAAGGTGG - Intergenic
1048602321 8:135931256-135931278 CCGGCCAGGTGTGTGCATGGTGG + Intergenic
1049641877 8:143719559-143719581 CAGGCTAGGACTGTGCTGAGAGG + Intronic
1053131513 9:35618213-35618235 CCGGTTAGGACAGGGTAAGGGGG - Exonic
1057005410 9:91553328-91553350 CCAGCTGGGACAGGGCAAGGTGG + Intergenic
1060212445 9:121718888-121718910 CCGCCTAGGACTGGGGGAGGGGG - Intronic
1061361945 9:130149157-130149179 CTGGCTAGGTGTGTTCAAGGAGG + Intergenic
1061504658 9:131025112-131025134 CCAGCTCGAACTGTGGAAGGCGG + Intronic
1062525132 9:136975170-136975192 CCGGCTAGGACTGTGCAAGGTGG - Intergenic
1190398746 X:50010727-50010749 CAGGCAAGGATTCTGCAAGGGGG + Intronic
1199757803 X:150881367-150881389 CTAGCTGGGACTGTGCCAGGTGG - Intronic