ID: 1062527850

View in Genome Browser
Species Human (GRCh38)
Location 9:136985485-136985507
Sequence CCGCGGGGCCCTCTACCTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062527836_1062527850 14 Left 1062527836 9:136985448-136985470 CCGCGGACCATGGGCCCTCCCAG 0: 1
1: 0
2: 0
3: 9
4: 184
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527841_1062527850 0 Left 1062527841 9:136985462-136985484 CCCTCCCAGCTCGGTGGGCTGCA 0: 1
1: 0
2: 9
3: 77
4: 233
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527842_1062527850 -1 Left 1062527842 9:136985463-136985485 CCTCCCAGCTCGGTGGGCTGCAC 0: 1
1: 0
2: 42
3: 71
4: 179
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527844_1062527850 -5 Left 1062527844 9:136985467-136985489 CCAGCTCGGTGGGCTGCACCGCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527833_1062527850 24 Left 1062527833 9:136985438-136985460 CCATGCGGAGCCGCGGACCATGG 0: 1
1: 0
2: 1
3: 4
4: 41
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527843_1062527850 -4 Left 1062527843 9:136985466-136985488 CCCAGCTCGGTGGGCTGCACCGC 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527832_1062527850 30 Left 1062527832 9:136985432-136985454 CCATGGCCATGCGGAGCCGCGGA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1062527838_1062527850 7 Left 1062527838 9:136985455-136985477 CCATGGGCCCTCCCAGCTCGGTG 0: 1
1: 1
2: 1
3: 26
4: 269
Right 1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062527850 Original CRISPR CCGCGGGGCCCTCTACCTTC GGG Exonic
900426991 1:2585441-2585463 AGGAGGGGCCCTCTACCCTCTGG - Intergenic
900618456 1:3576173-3576195 GCGCCGGGCCCTCCACCCTCCGG + Intronic
915563390 1:156700586-156700608 TCTTGGGGCCCTCTCCCTTCAGG + Exonic
918322800 1:183380991-183381013 CCACTGGCCCCTCTACCTCCAGG - Intronic
922883120 1:228997681-228997703 CCGCAGGGCCCTGTACCATCTGG + Intergenic
1067562667 10:47314776-47314798 CCGTGGGGACCCCTACCTGCTGG + Intergenic
1070342849 10:75513606-75513628 CAGCAGGGCCCTCTTCCCTCTGG + Intronic
1070596011 10:77833846-77833868 CCTGGGGCCCCTCTCCCTTCTGG - Intronic
1072693126 10:97584499-97584521 CCAGGGGGCCCTGTTCCTTCTGG - Exonic
1076872043 10:133199031-133199053 CCCCGGGGCCCTCTGGCTCCTGG - Exonic
1077298258 11:1835978-1836000 CAGCGGGGCCCTTCACCTCCTGG - Exonic
1083225228 11:61280862-61280884 CAGCAGGGCCCTCTCCCTGCTGG - Exonic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084033389 11:66493889-66493911 CCGAAGGGCCCTCTACATCCAGG - Intronic
1084174758 11:67417460-67417482 CCCAGGGGCCCTCTTCCTCCAGG - Exonic
1085561009 11:77473364-77473386 CCGCGAGGCCCGCTCCCGTCGGG - Intronic
1090186108 11:124740098-124740120 CCCCCGGGCCCTCTAACTTACGG - Exonic
1102453393 12:113057180-113057202 CCCCGGGGCCCTCGCCCTGCCGG - Intronic
1102547234 12:113665860-113665882 CAGCCGGCCCCTCTGCCTTCAGG + Intergenic
1103919829 12:124393506-124393528 CCGGTGGCCCCTCTACCTTCTGG + Intronic
1103963069 12:124621584-124621606 CCGAGGTGCCCACTACCCTCAGG + Intergenic
1106845695 13:33735777-33735799 CCCCGTGTCCCTCTATCTTCAGG - Intergenic
1108622244 13:52195615-52195637 CCGCGGGGCTCACTACATCCTGG - Intergenic
1122779061 14:104136064-104136086 CCGCGCTGCCCTCTCCCTGCCGG + Intergenic
1126102851 15:45130011-45130033 CCGCGGAGCCCTCTCTCGTCCGG - Exonic
1128320644 15:66691598-66691620 CCGCAGGCCCCTCTACCTGAAGG - Intergenic
1129336068 15:74852908-74852930 CCCCGGGGCCCTGCACCTGCTGG + Intronic
1129516198 15:76159174-76159196 CTGGGGAGCCCTCTACCCTCTGG + Intronic
1132588384 16:715854-715876 GCGCCGGGCCCTCTTCCTGCAGG + Exonic
1134841820 16:17407710-17407732 ACCCAGGGCCTTCTACCTTCTGG + Intronic
1143779496 17:9221895-9221917 CTGCGGGGCCCTCCTCCTGCAGG - Intronic
1147692244 17:42323437-42323459 CCTCAGGCCCGTCTACCTTCAGG + Intronic
1148339121 17:46863013-46863035 CTGTGGGGCCCTGTACCTTGGGG - Intronic
1152640500 17:81447358-81447380 CCTCGGGGCCCCCTGCCTCCAGG - Exonic
1153639874 18:7147724-7147746 CCTCAGGGCCCTCTTCCTTGTGG - Intergenic
1164739807 19:30567554-30567576 CCTCGGGGCCCTCTCGCTGCGGG - Intronic
1165426059 19:35746044-35746066 CCCCGAGGCCCTCTTCCCTCGGG - Intronic
1167278760 19:48554242-48554264 CCCTGGGGCCCACTTCCTTCGGG + Intronic
931516725 2:63054482-63054504 CCGCAGGGCGCTTTACATTCGGG - Intronic
932749936 2:74365107-74365129 CTCCGGGGCCCTCCTCCTTCAGG - Exonic
934515799 2:94985683-94985705 CCGCTGGCCCCTCTATCATCCGG - Intergenic
935061807 2:99615222-99615244 CTCCAGGGCCCTCTACCATCTGG - Intronic
948378379 2:237537060-237537082 CAGCGGGGCCCTCCACCTTGAGG + Intronic
1172977989 20:38920614-38920636 CCCATGGGCCCTCTACTTTCTGG - Exonic
1173788321 20:45811429-45811451 CTGCTGTGCCCTCTACCTTGTGG + Intergenic
1173856005 20:46251260-46251282 GCCCGGAGCCCCCTACCTTCGGG + Exonic
1175156112 20:56972762-56972784 CCCCGGGCCCCTCTGCCTTCTGG - Intergenic
1175367841 20:58467705-58467727 CCGCGAGCCCCTCTCCCCTCTGG + Intronic
1177894563 21:26844498-26844520 GCGCGGCGCCTTCTACCTGCTGG - Exonic
1178429243 21:32504555-32504577 CCGCGGGGACCTCTTCATTGAGG + Intronic
1178915110 21:36701562-36701584 CCGCGGGGCGCTCTCCTCTCGGG + Intronic
1183406369 22:37632509-37632531 CCTGGGGGCCCCTTACCTTCTGG - Exonic
1184456953 22:44616299-44616321 CCTTGGAGCCCTCTCCCTTCTGG + Intergenic
1184684799 22:46091407-46091429 CTGCTGGGCCCTCTTCCTCCAGG + Intronic
1184684809 22:46091443-46091465 CTGCTGGGCCCTCTTCCTCCAGG + Intronic
1184684835 22:46091551-46091573 CTGCTGGGCCCTCTTCCTCCAGG + Intronic
1184684844 22:46091587-46091609 CTGCTGGGCCCTCTTCCTCCAGG + Intronic
949371357 3:3337992-3338014 CAGCAGGGCCCTCTACCATCTGG + Intergenic
965550484 3:169959987-169960009 CCGGGGGAACCTCTACCTTTGGG - Intergenic
969669474 4:8581826-8581848 CTGCGGGGGCCTCTGCCTCCTGG + Intronic
981993727 4:150954180-150954202 CAGAGGGGCCCCCCACCTTCTGG - Intronic
985537917 5:474920-474942 CCTCGGGGCCGTCTGCCTGCAGG + Exonic
987290683 5:16505620-16505642 CCTAGGGTCCCTCTCCCTTCAGG + Intronic
992940017 5:81751752-81751774 GCGCGGTTCCCTCGACCTTCTGG + Intronic
997593535 5:135091174-135091196 CGGGTGGGCCCTCAACCTTCAGG - Intronic
999101608 5:149030039-149030061 CTGCGGGGCTTTCTACCCTCTGG - Intronic
999265690 5:150265361-150265383 CCGCTGGGCCCTCTCACTTCAGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002565434 5:180110589-180110611 TCCCGGGGCCCTCTGCTTTCAGG - Intronic
1007785326 6:44276416-44276438 CCACGACGCCCTCTACTTTCCGG + Exonic
1017021548 6:150143648-150143670 CCGCGGTGCCCTCTGGCGTCGGG + Intronic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1026833633 7:73624259-73624281 CCGTGGGGCCCTCCGACTTCGGG - Exonic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1029139871 7:98401635-98401657 CCACGGGTCCCTCTAACTTTTGG - Intergenic
1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG + Intergenic
1049703191 8:144024203-144024225 CCTCAGGACCCTCTACCCTCAGG + Intronic
1061052155 9:128203349-128203371 CCGCGGGGCCCCCGCCCCTCGGG - Intronic
1062008797 9:134256154-134256176 CCGCCGGGCCCCCTTCCTTCTGG - Intergenic
1062146471 9:134992334-134992356 CCGGGGGGCCTTCCTCCTTCCGG - Intergenic
1062521490 9:136959755-136959777 CCTCGGGGCACTCTACCCACCGG + Intergenic
1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG + Exonic
1062735374 9:138134535-138134557 CCGTGGGGCCCAGTGCCTTCTGG + Intergenic
1188953507 X:36406553-36406575 CTTCTGGGCCCTCTACGTTCAGG + Intergenic
1195454279 X:105051085-105051107 CAGCTGGGCCCTCAGCCTTCAGG + Intronic
1196893146 X:120309469-120309491 CCCCGGGCCCGTCTGCCTTCGGG - Intronic