ID: 1062530244

View in Genome Browser
Species Human (GRCh38)
Location 9:136996511-136996533
Sequence CTTGACAAACAGCTGGAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062530232_1062530244 14 Left 1062530232 9:136996474-136996496 CCCAGACACCCTCCCCGCAGCTG 0: 1
1: 0
2: 1
3: 29
4: 253
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530231_1062530244 17 Left 1062530231 9:136996471-136996493 CCTCCCAGACACCCTCCCCGCAG 0: 1
1: 0
2: 3
3: 42
4: 418
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530236_1062530244 2 Left 1062530236 9:136996486-136996508 CCCCGCAGCTGAGTCCGCCCTGC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530238_1062530244 0 Left 1062530238 9:136996488-136996510 CCGCAGCTGAGTCCGCCCTGCAC 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530233_1062530244 13 Left 1062530233 9:136996475-136996497 CCAGACACCCTCCCCGCAGCTGA 0: 1
1: 0
2: 0
3: 19
4: 240
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530234_1062530244 6 Left 1062530234 9:136996482-136996504 CCCTCCCCGCAGCTGAGTCCGCC 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530235_1062530244 5 Left 1062530235 9:136996483-136996505 CCTCCCCGCAGCTGAGTCCGCCC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
1062530237_1062530244 1 Left 1062530237 9:136996487-136996509 CCCGCAGCTGAGTCCGCCCTGCA 0: 1
1: 0
2: 1
3: 21
4: 177
Right 1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062530244 Original CRISPR CTTGACAAACAGCTGGAGCT TGG Exonic
901156780 1:7145537-7145559 CTTGGGAATGAGCTGGAGCTGGG + Intronic
902973964 1:20075294-20075316 CTGGCCAAAGAGATGGAGCTGGG - Intronic
903326211 1:22569977-22569999 CTTGACAAGCAGGTGGACTTGGG + Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907724263 1:57004221-57004243 CATGCCAAAGAGCTGGGGCTGGG - Intronic
909215314 1:72879294-72879316 CTGGACAAACTGCTTGAACTGGG - Intergenic
909851182 1:80466151-80466173 TGTGTCAAACAGCTGGAGCCTGG - Intergenic
910220129 1:84881250-84881272 CTTCAGAATCAGCTGGACCTGGG + Intronic
910557910 1:88557132-88557154 TTTGGCATTCAGCTGGAGCTGGG + Intergenic
910813757 1:91265948-91265970 CTTGACACATAGTTGGAGATGGG - Intronic
911099588 1:94084440-94084462 GCTGACAAACAGGTGGAGTTAGG + Intronic
913568153 1:120093957-120093979 CTTGAGAAACAGCAGCAACTGGG + Intergenic
914288962 1:146254981-146255003 CTTGAGAAACAGCAGAAACTGGG + Intergenic
914549997 1:148705724-148705746 CTTGAGAAACAGCAGCAACTGGG + Intergenic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
918430993 1:184460577-184460599 CTTGATAAGCATCTGGAGTTGGG + Intronic
921157811 1:212452014-212452036 CTTGACAACAGGCTGGAGTTTGG + Intergenic
921292380 1:213670646-213670668 GTTGACAAACATCTGCACCTGGG + Intergenic
921914857 1:220595957-220595979 CTTGACAGACATATGGAGCTGGG + Intronic
922007696 1:221548943-221548965 CTTGAGAAACACCTGCAGTTTGG - Intergenic
922456211 1:225775640-225775662 CTGGACAAACACCAGGAGCTGGG - Intergenic
1063345372 10:5307054-5307076 CTTCCCAAGCAGCTGGGGCTAGG - Intergenic
1063752449 10:8965877-8965899 TTTGCCAAACAGTTGGATCTGGG + Intergenic
1065816037 10:29483320-29483342 CCTGACTTACAGCTGGAACTGGG + Intronic
1067161405 10:43827905-43827927 CTGGACAAGCAGCAAGAGCTGGG - Intergenic
1067401229 10:45975645-45975667 CCTCACAAACACCAGGAGCTTGG + Intronic
1067869581 10:49945223-49945245 CCTCACAAACACCAGGAGCTTGG + Intronic
1070347334 10:75557661-75557683 ATTGAGAATCAGCTAGAGCTGGG + Intronic
1071450814 10:85790327-85790349 AGTGACAAACTGCTGGGGCTTGG - Intronic
1074520741 10:114220481-114220503 CTTGGCAAAGACCTGGTGCTGGG + Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1076492872 10:130875400-130875422 CCTGAAAACCAGCTGGAGGTGGG - Intergenic
1077877537 11:6320555-6320577 CCTGAGTCACAGCTGGAGCTGGG - Exonic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1082120447 11:48374187-48374209 CCTCCCAAATAGCTGGAGCTGGG + Intergenic
1082171974 11:49015735-49015757 CAGGACAGACCGCTGGAGCTTGG + Intergenic
1083423599 11:62570849-62570871 CTTGGAAAACAGCTAGAGGTGGG - Intronic
1084564967 11:69923501-69923523 CATGAAATGCAGCTGGAGCTAGG + Intergenic
1086407760 11:86513591-86513613 CTTGACAGACACCTAGAGGTGGG + Intronic
1088939710 11:114440441-114440463 CTTGACAAATAGCAGGCCCTTGG + Intronic
1089272885 11:117314419-117314441 CTTCTCAGACAGCTGGATCTGGG - Intronic
1089397291 11:118144792-118144814 CTTAAGAAACACCCGGAGCTTGG - Intronic
1089795524 11:120977517-120977539 GTTGAAAAACAGATGGAGCGGGG - Intronic
1091322680 11:134663172-134663194 CTTGGCAGGCAGCTGGATCTAGG + Intergenic
1096804594 12:54132925-54132947 CTTGTCAACCAGCTGGGGCTGGG - Intergenic
1097465665 12:59921368-59921390 CTTGCCAAACTGCTGGTGGTGGG + Intergenic
1099641899 12:85300081-85300103 CATGACAAATGGCAGGAGCTGGG - Intronic
1099955802 12:89351951-89351973 CTCAACGAGCAGCTGGAGCTGGG - Exonic
1101236655 12:102796357-102796379 CTTTACAATCAGCTAGAACTTGG + Intergenic
1101821149 12:108185156-108185178 CTTGCCAAGCACCTGGACCTTGG + Intronic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1110136229 13:72070753-72070775 CAGGACCATCAGCTGGAGCTTGG + Intergenic
1110638307 13:77791466-77791488 CTAGACAAACCGCTAGTGCTTGG + Intergenic
1110894964 13:80737814-80737836 CTTGCCTAACAGCTCCAGCTAGG - Intergenic
1112605832 13:100904773-100904795 CGTGACAAACTTCTGGAGGTTGG - Intergenic
1114304782 14:21412614-21412636 CTTGACATACAGTTGGAGGTGGG - Intronic
1116204676 14:41848583-41848605 CATGACCAACAGTTGGAGGTTGG - Intronic
1119558717 14:75572937-75572959 CCAGTGAAACAGCTGGAGCTCGG + Intergenic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1119898363 14:78239568-78239590 CTTGAAGAACAGCAGGAGGTAGG - Intergenic
1119967550 14:78933956-78933978 ATTTACAAACAGCTGAAGATGGG - Intronic
1125344782 15:38708215-38708237 CTTGACACAGAGCTTGACCTTGG + Intergenic
1127894189 15:63280299-63280321 TTTGAAACACAGCTGGAACTTGG + Intronic
1128721615 15:69954636-69954658 CTTCACAAACAGCAGAAGGTGGG + Intergenic
1130300904 15:82679579-82679601 CTGAACAAACAGCTCCAGCTGGG + Intronic
1130796092 15:87210938-87210960 CTTGACCAACAGCTTGATTTTGG + Intergenic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1137586420 16:49666677-49666699 CCTGCCTAACAGCTGGAGATGGG + Intronic
1140892662 16:79298478-79298500 CTTGACAACCAGCTCCAACTGGG + Intergenic
1141334747 16:83144114-83144136 CTTGACCCACAGCTAGTGCTTGG + Intronic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1143652052 17:8269209-8269231 ATTGATAAAGAGCTGGAGCCAGG - Exonic
1145719602 17:27057713-27057735 CTTGCCAAACAGCAGTTGCTGGG - Intergenic
1146258147 17:31403700-31403722 CTTGAGTAACTGGTGGAGCTGGG + Intronic
1146571892 17:33960063-33960085 CTAAACCAACAACTGGAGCTAGG - Intronic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1153234926 18:2976909-2976931 AATCACAAACAGCTGGGGCTGGG + Intronic
1153261755 18:3230988-3231010 CTTGAGAGCCAGCTGGAACTGGG - Intergenic
1155613835 18:27699348-27699370 CCAGCCAAACAGCTGGGGCTTGG + Intergenic
1155706587 18:28823555-28823577 CTTTACAAAAAACTGCAGCTAGG - Intergenic
1155864678 18:30950623-30950645 CATGACACACAGTTGGAGGTAGG - Intergenic
1156157847 18:34324725-34324747 CTTTACAAACAGTTGGTGGTAGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1161130129 19:2583488-2583510 CTTGCCACACAGCTTGGGCTGGG - Intronic
1161130579 19:2586263-2586285 CTTGCCACACAGCTTGGGCTGGG - Intronic
1161450344 19:4342420-4342442 CTTGACATAGAGCAAGAGCTGGG - Intronic
1161895984 19:7080723-7080745 CAAGACAAACAGCTGAATCTGGG - Intronic
1161904557 19:7146531-7146553 CTTGACAAAGAGGTTGAGCATGG - Intronic
1166353518 19:42213029-42213051 CTTGAAAAACAGCTGATTCTAGG + Intronic
925739025 2:6989021-6989043 CTGGACAAACAGCTGATTCTAGG - Intronic
926386224 2:12338231-12338253 CTAGACAGACAGCTGGAGATTGG - Intergenic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
927701293 2:25270536-25270558 CCTGGGGAACAGCTGGAGCTGGG + Intronic
929227550 2:39526136-39526158 CTCGACAAACAGCTTGTGCCAGG + Intergenic
929273339 2:39998737-39998759 CATCACAAAGAGCTGCAGCTTGG - Intergenic
929889304 2:45906119-45906141 CCTGACACATTGCTGGAGCTAGG + Intronic
931089410 2:58869369-58869391 CTTCCCAAACATGTGGAGCTTGG - Intergenic
932466641 2:71928424-71928446 GCTGGCAAACAGCTGGGGCTTGG - Intergenic
932759312 2:74429088-74429110 CCTGACACTTAGCTGGAGCTCGG - Intronic
935662064 2:105475408-105475430 CTTGAATGACAGGTGGAGCTAGG + Intergenic
939569374 2:143822389-143822411 CTTGGCAAAGAGCTAGAACTAGG - Intergenic
942654906 2:178205076-178205098 ATTTACAAACTGCAGGAGCTTGG - Intronic
946140514 2:217686749-217686771 CTTCACAAAGATCTGGAGGTTGG - Intronic
947363617 2:229371576-229371598 CTAAACAAACACCTTGAGCTAGG + Intronic
1168745084 20:232597-232619 TTTGACAAATAGCTGTAGCAGGG - Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1170042741 20:12055107-12055129 CTTGCCAAACAGCTTTAACTTGG + Intergenic
1172580671 20:36044851-36044873 CCTGACACACAGCAGGTGCTTGG - Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1174677532 20:52372940-52372962 CTTGACAAACAGAAGGCACTGGG - Intergenic
1174872409 20:54195484-54195506 GTTGACAAACAGCTGTGGCCAGG + Intergenic
1175165150 20:57038322-57038344 CTTGGCACACAGTAGGAGCTCGG - Intergenic
1175825157 20:61932985-61933007 CATGACAAACAGCAGGACCATGG - Exonic
1175876555 20:62232911-62232933 CTTGCCCCTCAGCTGGAGCTGGG - Intronic
1176997552 21:15574387-15574409 CTTTTCAAAGAGCTGGTGCTTGG - Intergenic
1177596928 21:23256499-23256521 CTTTAGAAACATCAGGAGCTAGG - Intergenic
1178925133 21:36768417-36768439 CTTTACAAATGGCTGGAACTCGG + Intronic
1179790888 21:43755399-43755421 CTTGGCAGGCAGCAGGAGCTTGG - Intronic
1180056976 21:45364035-45364057 CCTGACACACAGTAGGAGCTTGG + Intergenic
1184035947 22:41918189-41918211 CATGACAAACAGCCTGTGCTGGG + Intergenic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
949926110 3:9043150-9043172 CTTAAAAAACAGCTGGGGGTGGG - Intronic
953432341 3:42850541-42850563 CTTGACACACAGCAAGTGCTTGG - Intronic
954375566 3:50192522-50192544 CTGGTCAACCAGCTGGAGGTGGG + Intronic
955709724 3:61765672-61765694 CTTGACAAAAAGCTGGATCACGG - Intronic
963569155 3:146970339-146970361 CGTGACAATTAGTTGGAGCTAGG + Intergenic
967619540 3:191616312-191616334 TTAGAAAAACAGCTGGATCTCGG + Intergenic
968535174 4:1122062-1122084 CTTGACAAGTGGCTGGAGCTAGG + Intergenic
968615473 4:1575736-1575758 CTTGCCAGAGAGCAGGAGCTGGG + Intergenic
972580172 4:40388192-40388214 CTTGACACAGAGGAGGAGCTGGG - Intergenic
973199579 4:47485163-47485185 TCGGTCAAACAGCTGGAGCTGGG + Intergenic
975283432 4:72589760-72589782 TTTGAGAAACAGTTGGATCTGGG + Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
976364256 4:84215347-84215369 TATGACAGACAGCTGGGGCTGGG - Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980385051 4:132078195-132078217 CATGACAAACAGCTGCAACTAGG - Intergenic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
983502164 4:168511995-168512017 CTTGTCACACAGCTGGCTCTGGG - Exonic
984214930 4:176899341-176899363 CTTGTGAAATAGATGGAGCTAGG + Intergenic
985489516 5:171211-171233 CAGGACAAGCAGCGGGAGCTAGG + Exonic
987393400 5:17398032-17398054 CTTGCCAAACATCTGATGCTGGG - Intergenic
990420455 5:55626947-55626969 CCTCAGAAACATCTGGAGCTAGG + Intronic
990997467 5:61746752-61746774 CCTGACACCCAGCTGGACCTTGG - Intronic
991706032 5:69359587-69359609 TTTGACAAACAGCAGCAGCTGGG - Intronic
992753955 5:79886835-79886857 TATAACAAACAGCTGGAGTTAGG - Intergenic
992884206 5:81141579-81141601 CTTCAAAAACAGCAAGAGCTTGG + Intronic
992942872 5:81780087-81780109 CTTGAGCAACAGCAGGAGCTGGG - Intergenic
993074460 5:83211151-83211173 CTTGAAAAACTGCTGAAGTTTGG + Intronic
996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG + Intergenic
997418055 5:133744370-133744392 CTTATCACACAGCAGGAGCTGGG - Intergenic
997491308 5:134278892-134278914 ATTGAAAGAAAGCTGGAGCTGGG - Intergenic
998979492 5:147685997-147686019 GTAGACAACCAGCTGAAGCTAGG + Intronic
1001847802 5:174937286-174937308 CATGGCAAACAGCAGGTGCTGGG + Intergenic
1003587361 6:7404766-7404788 CTTGACTAACAGATGGAACTGGG - Intronic
1004252982 6:14037359-14037381 GTTGACTAAAACCTGGAGCTGGG - Intergenic
1004277453 6:14250980-14251002 ATTGACACACATGTGGAGCTGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007967395 6:46015480-46015502 CTTCACAAAGAGCTCGATCTCGG + Intronic
1009972443 6:70639163-70639185 TTTGACAAACAGCTTCATCTCGG - Intergenic
1017063846 6:150510305-150510327 CTTTACAAGCAGAGGGAGCTGGG + Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1020104492 7:5415745-5415767 CTGGACAACCACCTGGAGATGGG - Intronic
1020104892 7:5418194-5418216 ACTGACAAACACCTGGGGCTTGG - Intronic
1023403737 7:39810486-39810508 CTTGTCCAACAGGTGGAGCGAGG + Intergenic
1023522353 7:41061097-41061119 CTTGACACACAGCTACAGCCTGG - Intergenic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1028581732 7:92416108-92416130 CTTGTCAATCAGCTCTAGCTAGG - Intergenic
1032373101 7:131379981-131380003 TTTGACAAACCCCTGGAGCCAGG + Intronic
1036490704 8:9222834-9222856 ATTGACAAAGACCTGGAGGTGGG + Intergenic
1037677912 8:21067754-21067776 CTTAACAATCAGATGGAGTTTGG + Intergenic
1038439659 8:27562549-27562571 CTTGCCTAACAGCTGGTGCAAGG - Intergenic
1039090621 8:33825279-33825301 CCTGATAAACTGCTGGATCTAGG + Intergenic
1046467464 8:114624866-114624888 CTTGTCTAATTGCTGGAGCTAGG + Intergenic
1048233184 8:132663858-132663880 CCTGACAAACAGCTGACCCTTGG - Intronic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1049636421 8:143691937-143691959 GATGACATACAGCTGCAGCTCGG + Intronic
1050286250 9:4105339-4105361 CTTGTCAAACAGCTGTGCCTGGG - Intronic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1056534182 9:87513566-87513588 CTAGACCAGCAGCTGGAGGTAGG + Intronic
1056945992 9:90997233-90997255 CTTGACAAACACATGCAGTTTGG - Intergenic
1057742996 9:97728441-97728463 CATGAAAGACACCTGGAGCTGGG + Intergenic
1058264552 9:102882612-102882634 CTTGATAAACAGCAGCAGCCAGG - Intergenic
1059784658 9:117567785-117567807 CTTCACAAAGATCTGGAGGTTGG + Intergenic
1062364169 9:136201153-136201175 CTTCACCATCACCTGGAGCTGGG + Intronic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1187708542 X:22030882-22030904 CTTAACAACCAGCTTCAGCTGGG - Intergenic
1190212283 X:48458589-48458611 CCTGACAAACAGCTTCAGCCAGG + Exonic
1192932404 X:75821482-75821504 ATAGACAAAGAACTGGAGCTTGG - Intergenic
1197501588 X:127248968-127248990 TTCTACAAAGAGCTGGAGCTAGG + Intergenic
1198816138 X:140592756-140592778 TTTGACAAGCAGCACGAGCTCGG - Intergenic