ID: 1062532407

View in Genome Browser
Species Human (GRCh38)
Location 9:137007712-137007734
Sequence TGCCAAAGGCTGACCCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062532407_1062532415 10 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532415 9:137007745-137007767 CGGCAACCGCAGTGACCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1062532407_1062532419 26 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532419 9:137007761-137007783 CACAGGGCATGGCCGAGTACAGG 0: 1
1: 0
2: 2
3: 29
4: 250
1062532407_1062532420 27 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532420 9:137007762-137007784 ACAGGGCATGGCCGAGTACAGGG 0: 1
1: 0
2: 2
3: 26
4: 164
1062532407_1062532421 28 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532421 9:137007763-137007785 CAGGGCATGGCCGAGTACAGGGG 0: 1
1: 0
2: 0
3: 35
4: 335
1062532407_1062532416 15 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532416 9:137007750-137007772 ACCGCAGTGACCACAGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 216
1062532407_1062532412 -10 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532412 9:137007725-137007747 GCCTTTGGCACAATTAGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 88
1062532407_1062532414 9 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532414 9:137007744-137007766 GCGGCAACCGCAGTGACCACAGG 0: 1
1: 0
2: 1
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062532407 Original CRISPR TGCCAAAGGCTGACCCGGCC CGG (reversed) Exonic
900461613 1:2804652-2804674 TGCCAAAGGCAGTGCAGGCCTGG - Intergenic
901237100 1:7672969-7672991 TGTGATAGGCAGACCCGGCCTGG - Intronic
902679222 1:18031247-18031269 TGCCAAAGGCTCACTGGCCCCGG + Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG + Intergenic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
913109328 1:115642794-115642816 TGGCGAAGGCTGCCCCGGCGCGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916549930 1:165840212-165840234 TTTTAAAGGCTGACCAGGCCGGG - Intronic
918580384 1:186120102-186120124 TGCCCAAGGCTGTACCAGCCGGG - Exonic
919351824 1:196466890-196466912 TACCCAAGGCTGACCCTGCTTGG - Intronic
919455376 1:197814757-197814779 GGCCAAAGCCTGTCCCGGACTGG + Intergenic
922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG + Intronic
1067684295 10:48457706-48457728 TGCTAAAGCCTCACCAGGCCTGG - Intronic
1069729148 10:70599986-70600008 TGAGGAAGGATGACCCGGCCAGG + Intronic
1074424068 10:113335748-113335770 TGACAAAGGCTGACCTTGGCTGG + Intergenic
1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG + Intergenic
1077134780 11:993072-993094 TGCCACACGCTGACCTGCCCTGG - Intronic
1078638751 11:13076443-13076465 TACCTAAGGCAGACCAGGCCAGG + Intergenic
1081583319 11:44367070-44367092 TGGAAGAGGCTGACCCTGCCTGG + Intergenic
1084959427 11:72708676-72708698 GGCCAAAGGCCCACCAGGCCTGG + Intronic
1085203788 11:74718080-74718102 TGCCAAAGGCTGAGCCACCTGGG - Intronic
1090351239 11:126109947-126109969 TGGCAGAGGGTGACACGGCCAGG + Intergenic
1094545638 12:31402124-31402146 TGCCAAAGGATGACCAGGTTTGG + Intronic
1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG + Intergenic
1119266661 14:73266762-73266784 TGCCAGAGGGTGATACGGCCAGG + Exonic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1119756403 14:77123070-77123092 TGCAAATGGCTGACCAGGCACGG - Intronic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122930958 14:104932935-104932957 TGCCAAACGCAGTCCTGGCCCGG - Exonic
1123113396 14:105883192-105883214 GGCCAAAGGCTGGGCCTGCCAGG - Intergenic
1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG + Intronic
1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG + Exonic
1126497329 15:49306635-49306657 TGCCTAGGGCTGGCCTGGCCTGG - Intronic
1129071222 15:72953094-72953116 TCCCAAAGGCTGATCCTCCCAGG + Intergenic
1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG + Intergenic
1132485347 16:187432-187454 TGCCACAGGCTGTCCCCTCCAGG - Intergenic
1132626838 16:895266-895288 AGCCCGAGGCTGACCCGACCAGG - Intronic
1134882442 16:17757474-17757496 TCCCAAAGGCTGGCCAGGCGAGG - Intergenic
1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG + Intronic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1141766419 16:86062674-86062696 TGCCGCAGGCTGACCAGGCAGGG + Intergenic
1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG + Intergenic
1143595971 17:7914252-7914274 TGCCAGAGTCTGGCCCGGCGCGG + Intergenic
1144845765 17:18218041-18218063 TGCCAAAGGAGGCCCCGGTCTGG - Intergenic
1146359022 17:32159320-32159342 TGCCAACGGGTAACTCGGCCCGG - Intronic
1148475056 17:47923137-47923159 TGCCAAAGATTGCCCCAGCCGGG + Exonic
1148776310 17:50097355-50097377 AGCCAAAGGATGTCTCGGCCAGG - Intronic
1151426452 17:74033864-74033886 TGCCAAAGACAGACCCGGGAAGG - Intergenic
1151632467 17:75320239-75320261 GGTCACAGGGTGACCCGGCCAGG + Exonic
1155442923 18:25880896-25880918 GGCCAAAGGCTGACATGACCAGG + Intergenic
1160234196 18:77072908-77072930 TGACAATGGCTGAACAGGCCAGG - Intronic
1160413150 18:78688413-78688435 TGCCCAGGGCAGACTCGGCCTGG + Intergenic
1162125139 19:8495528-8495550 TGCACAAGGCTGGCCCGGCGTGG - Intronic
1162432043 19:10634944-10634966 GGGCAAAGGCTGAGCCGGCTGGG - Intronic
1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
925331621 2:3063053-3063075 GGCCAGAGGCTGACTCAGCCAGG + Intergenic
926618214 2:15020934-15020956 TACAAAAAGCTGACCTGGCCAGG + Intergenic
927677798 2:25119343-25119365 AGCCAAAGGCTGGTCCGGTCAGG - Intronic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG + Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
936428180 2:112436703-112436725 GGCCACAGGCTGACCCGTGCAGG + Intergenic
940916817 2:159265434-159265456 TTACAAAGACTGACCCGGCTAGG + Intronic
941580953 2:167294218-167294240 TGCCAGAGGCGCACCAGGCCGGG - Intergenic
944460332 2:199942355-199942377 TGCAAAAGGCTGGCCGGGCGCGG - Intronic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1172513194 20:35514750-35514772 TGCCAAAGGCTGTCTGCGCCAGG + Exonic
1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG + Intronic
1176119391 20:63447145-63447167 TGCCAAAGGATGAGGCTGCCAGG - Intronic
1176374071 21:6078508-6078530 GGCCACAGGCTGACCCGTGCAGG - Intergenic
1178863613 21:36309610-36309632 TGAAAAAGGGAGACCCGGCCGGG - Intergenic
1178960271 21:37058697-37058719 TGCCAAAGGCTCACAGGGCTTGG - Intergenic
1179749406 21:43459735-43459757 GGCCACAGGCTGACCCGTGCAGG + Intergenic
1180109441 21:45641262-45641284 TGACACACGCTGATCCGGCCTGG - Intergenic
1180354813 22:11829699-11829721 TGCCAGACCCTGTCCCGGCCCGG - Intergenic
1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG + Intergenic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181684651 22:24520142-24520164 TCCCAAAGGCTGTTCAGGCCAGG + Intronic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG + Intergenic
953566007 3:44032655-44032677 TGACAAAGGCTGAACAGGCAAGG - Intergenic
953867737 3:46598895-46598917 TGGCATAGGCTGACCAGACCAGG - Intronic
961239580 3:125398778-125398800 TGCCTAAGGCTGACCAAGCATGG - Intergenic
968001054 3:195207084-195207106 TACCACAGGCTGAGCCAGCCTGG + Intronic
968457274 4:706092-706114 TGCCAAGGGCTTCCCGGGCCAGG - Intronic
969320706 4:6410727-6410749 TGAGAAAGGGTGACCTGGCCAGG - Intronic
969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG + Intronic
971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG + Intergenic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
973373347 4:49270933-49270955 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
973387661 4:49524275-49524297 TGCCAGACCCTGCCCCGGCCTGG - Intergenic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
990417137 5:55597350-55597372 TGCCAAAGGATGACAAAGCCAGG + Intergenic
997735382 5:136209123-136209145 TGCAGAAGGCAGACCCAGCCAGG + Intergenic
1003069245 6:2931691-2931713 TGACAAATGCTGACCCAGGCAGG - Intergenic
1004193946 6:13487582-13487604 TCCCAGAGCCTGAGCCGGCCTGG - Intronic
1007174688 6:39887796-39887818 TGCCAGACGCTGACCAGGCTGGG - Intronic
1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG + Intergenic
1008609896 6:53176099-53176121 TGCAAAAGGCTAACCAGGGCCGG - Intergenic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG + Intronic
1017282185 6:152637032-152637054 GCCCAGAGGCTGAACCGGCCTGG - Intronic
1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG + Intronic
1023028670 7:36074482-36074504 TGCCACAGGCTGACAGGGCCTGG - Intergenic
1023136318 7:37056304-37056326 TGTGAAAAGCTGACCCTGCCTGG - Intronic
1028158072 7:87454852-87454874 TGCTAAAGGCTGAGACCGCCAGG - Intronic
1029111732 7:98216194-98216216 GGCGAGAGGCTGGCCCGGCCCGG - Exonic
1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG + Exonic
1038347648 8:26747094-26747116 TGCCCAAGGGTGACACAGCCTGG - Intergenic
1039110663 8:34037923-34037945 TGCCAAAAGCTGGCCAGGCATGG - Intergenic
1050367593 9:4886913-4886935 TGCCACAGAATCACCCGGCCAGG - Intergenic
1056630632 9:88290363-88290385 TGCCAAACTCTGACCAGGCGTGG + Intergenic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1057192275 9:93094793-93094815 TGCCAGAGCCTGACCCGGAATGG - Intergenic
1057314903 9:93961692-93961714 TACCAGAGGCTGATCCTGCCTGG - Intergenic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1060937066 9:127522016-127522038 GGCTAACGGCTGACCTGGCCTGG - Intronic
1061027000 9:128056265-128056287 TGACAAAGGCTGAGCCTGGCAGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062733468 9:138121652-138121674 AGCCCACGGCTGAGCCGGCCTGG - Exonic
1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1203552153 Un_KI270743v1:172093-172115 TGCCAGACCCTGCCCCGGCCCGG - Intergenic
1189254557 X:39627702-39627724 TGACAATGGGTGACCCAGCCCGG + Intergenic
1189267075 X:39725314-39725336 ACCCAAAGGCTGACCTGGGCAGG + Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1198394583 X:136208804-136208826 TTGCAAAGGCTAACCTGGCCTGG - Intronic
1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG + Intronic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic