ID: 1062532412

View in Genome Browser
Species Human (GRCh38)
Location 9:137007725-137007747
Sequence GCCTTTGGCACAATTAGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062532407_1062532412 -10 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532412 9:137007725-137007747 GCCTTTGGCACAATTAGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 88
1062532406_1062532412 -9 Left 1062532406 9:137007711-137007733 CCCGGGCCGGGTCAGCCTTTGGC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1062532412 9:137007725-137007747 GCCTTTGGCACAATTAGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 88
1062532396_1062532412 30 Left 1062532396 9:137007672-137007694 CCGAGGCTTTAAGGCAAAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 173
Right 1062532412 9:137007725-137007747 GCCTTTGGCACAATTAGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062532412 Original CRISPR GCCTTTGGCACAATTAGGGG CGG Exonic
903139930 1:21333281-21333303 GCCTTCAGCCCAAATAGGGGTGG - Intronic
907944425 1:59121961-59121983 ACCTTTGGGACAATTTGGAGTGG - Intergenic
915736359 1:158087996-158088018 CCCTTTGGCCCACCTAGGGGAGG - Exonic
916302982 1:163296199-163296221 ATCTTTGGCAGAAGTAGGGGTGG + Intronic
1067016062 10:42756885-42756907 ACCTTTGGCAAAACTAGGAGCGG - Intergenic
1069608966 10:69759664-69759686 GTCTCAGGCATAATTAGGGGTGG - Intergenic
1070648911 10:78220961-78220983 GCCATAGGCACAAGTAGGAGTGG - Intergenic
1071713862 10:88075670-88075692 GCCTGTGGTACATTTAGGGTTGG - Intergenic
1074674235 10:115830064-115830086 GACTTTGGCAGTATTAGGGCAGG - Intronic
1077626764 11:3779230-3779252 GGCTTTGGCACTACTAGTGGAGG - Exonic
1079417611 11:20254183-20254205 ACCTTTGGCAAAATCAGGGAAGG + Intergenic
1085196200 11:74673240-74673262 GCCTTTGGCACATGTCTGGGGGG + Intergenic
1085621588 11:78041792-78041814 GCCTTTAGCACGATTGGGAGTGG - Intronic
1088879821 11:113964593-113964615 GCCTTTAGCCCAATCAGGAGTGG - Intergenic
1092244866 12:6858232-6858254 GCCTCTGGGACAATTATGTGTGG + Intronic
1093274844 12:17112355-17112377 GCCTCTGGCAGAATTAAAGGAGG + Intergenic
1093321573 12:17720765-17720787 GCTTTGGGCAGGATTAGGGGTGG + Intergenic
1097315618 12:58167946-58167968 TCTTTTGCCACAATTAGTGGGGG - Intergenic
1098203194 12:68078972-68078994 GCCTGAGGCAGAATGAGGGGAGG + Intergenic
1098577075 12:72054563-72054585 GCCTTTCTTACAATTAGGTGTGG + Intronic
1108876221 13:55054128-55054150 GCCTTTAGCAAAATCAGGAGTGG - Intergenic
1109533675 13:63687259-63687281 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
1113534741 13:111056705-111056727 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
1114383868 14:22236839-22236861 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
1114840863 14:26260688-26260710 GCCTTTAGCCCAATTAGGAGTGG - Intergenic
1115443652 14:33464541-33464563 GCATTTGGAAAAATTAGGAGGGG - Intronic
1116363476 14:44030586-44030608 ACCTTCCGCAAAATTAGGGGAGG + Intergenic
1126255158 15:46616768-46616790 GCCTTTGTCAGAACGAGGGGAGG - Intergenic
1134216260 16:12319107-12319129 GGCCTGGGCACAACTAGGGGTGG + Intronic
1134630144 16:15750372-15750394 GCCTCTGGCCTATTTAGGGGTGG - Intronic
1138633802 16:58320425-58320447 GTCTTTTTCACATTTAGGGGAGG + Intronic
1145923783 17:28630829-28630851 GCCTTTCCCCCAATTAGGGAAGG - Intronic
1146089605 17:29863118-29863140 GCTTTTGGCATCTTTAGGGGAGG + Intronic
1148669720 17:49401720-49401742 TGCTTTGGCACAATTATTGGTGG + Intronic
1151465217 17:74280612-74280634 GCCTTTTGGACAATTGGGTGGGG + Intronic
1158490056 18:57901945-57901967 GCCTTTCCCAGAATTAGGTGTGG + Intergenic
1164948010 19:32312314-32312336 GACTTTGGCACACGTAGGTGGGG + Intergenic
932918201 2:75879198-75879220 GCCTTTAGCCCAATCAGGAGTGG - Intergenic
933857251 2:86427840-86427862 GCCTTGGGCACAAAAGGGGGAGG + Intergenic
936387719 2:112044741-112044763 GCCTTTAGCCCAATTGGGAGGGG + Intergenic
937594990 2:123661675-123661697 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
940453533 2:153870809-153870831 GTTTTTGGCAGAATTGGGGGAGG - Intergenic
941215118 2:162697194-162697216 CCCTCTGGCAAAATTATGGGTGG - Intronic
943689780 2:190857813-190857835 AACTTAGGCAGAATTAGGGGTGG - Intergenic
1169531385 20:6488921-6488943 TCCTTTGACATAATTAGGTGTGG - Intergenic
1174611733 20:51802653-51802675 GCCTTTGTCACAAGTAGGCCCGG - Intergenic
1175380401 20:58558781-58558803 GCCCTTGGCTCAATGAGGGTGGG + Intergenic
1177531174 21:22360043-22360065 GCCTTTAGCCCAATCAGGAGTGG + Intergenic
951514070 3:23538585-23538607 GCCTATGGGAAACTTAGGGGAGG - Intronic
951837665 3:27001243-27001265 GCCTTTAGCCCAATTGGGAGAGG - Intergenic
952833576 3:37585523-37585545 CCCGTTGGGACAATTAGGGAGGG + Intronic
956548545 3:70435198-70435220 GCTTTGGGCAGGATTAGGGGCGG + Intergenic
958629226 3:96666727-96666749 GCCTTTAGCCCAATTGGGAGTGG + Intergenic
964469816 3:157040828-157040850 GTATTTGGCACAATTTTGGGGGG - Intronic
967931686 3:194694753-194694775 TCATTTGGCACAATTTAGGGAGG - Intergenic
970990053 4:22202580-22202602 GACTTTGGGAAATTTAGGGGAGG + Intergenic
972423948 4:38915318-38915340 GCCTTTTGCACCATGAGGTGGGG - Intronic
975903810 4:79185957-79185979 CACTTTGGCACAATGTGGGGCGG - Intergenic
980790453 4:137613374-137613396 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
983071682 4:163275283-163275305 GCCTGTGGAATAATTAGGTGAGG + Intergenic
984291671 4:177803271-177803293 GCCTTGGGAACAAACAGGGGTGG - Intronic
988942890 5:36163772-36163794 CCCTTTGGCAAACGTAGGGGAGG + Intronic
989353405 5:40514618-40514640 GGCCTGGGCACAATGAGGGGTGG - Intergenic
989688030 5:44111568-44111590 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
990741392 5:58916026-58916048 GCCTTTAGCCCAATCAGGAGTGG - Intergenic
992698257 5:79312874-79312896 ACCATTGGCAGAATTAGAGGTGG + Intronic
993549913 5:89260612-89260634 GCTCATGGAACAATTAGGGGAGG + Intergenic
996110220 5:119556599-119556621 GGCTTTAGACCAATTAGGGGAGG - Intronic
999670674 5:153956786-153956808 GCCTTTGGGGCATTTAGGGGAGG - Intergenic
999948754 5:156626017-156626039 ATCTTTGGCACAATTTGGTGGGG + Intronic
1001097510 5:168787201-168787223 GCATTTGGCACAGTGAGCGGTGG - Intronic
1005816675 6:29558691-29558713 GCCTTTAGCCCAATCAGGAGCGG - Intronic
1010895046 6:81351584-81351606 GCCTTTAGCCCAATTGGGAGTGG - Intergenic
1012734519 6:102921596-102921618 GCCTCTAGCCCAATTAGGAGTGG + Intergenic
1015084767 6:129277080-129277102 GCATTTTCCACAAATAGGGGAGG - Intronic
1024557534 7:50616164-50616186 GACTGTGGCAGAATTAGGGCTGG + Intronic
1028589068 7:92477691-92477713 GCCTTTAGCCCAATTGGGAGCGG + Intronic
1032831834 7:135635067-135635089 GGCTATGGCACTATTAGAGGTGG + Intronic
1034249516 7:149676922-149676944 GCCTTTAGCCCAATCAGGAGCGG - Intergenic
1041724977 8:61009932-61009954 ACCTTTGGCACAATAAGGCCAGG - Intergenic
1042265980 8:66909879-66909901 GCCTCTGGGACTATGAGGGGAGG - Intronic
1044515289 8:93130569-93130591 TCCTTAGGCACAACTAGTGGTGG + Intergenic
1044541680 8:93415427-93415449 GCCTTTGGAACAATGAGAAGAGG + Intergenic
1049710566 8:144061145-144061167 GCCTCTGGCACAAGGAGGGCTGG - Intronic
1050727657 9:8669948-8669970 TTCTTTGGCACAAGTAGGAGAGG - Intronic
1060559777 9:124533483-124533505 GCCCTTTGCACAGCTAGGGGAGG - Intronic
1062532412 9:137007725-137007747 GCCTTTGGCACAATTAGGGGCGG + Exonic
1187069417 X:15873541-15873563 GCCTTCGGCTCAGTTAGGGCAGG - Intergenic
1191182609 X:57579288-57579310 GACTTGGGCACAATCAGGGCTGG - Intergenic
1192940353 X:75904826-75904848 GCCTTTAGCCCAATCAGGAGTGG + Intergenic
1199268769 X:145858417-145858439 GCCTTTAGCCCAATCAGGAGTGG + Intergenic