ID: 1062532414

View in Genome Browser
Species Human (GRCh38)
Location 9:137007744-137007766
Sequence GCGGCAACCGCAGTGACCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062532406_1062532414 10 Left 1062532406 9:137007711-137007733 CCCGGGCCGGGTCAGCCTTTGGC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1062532414 9:137007744-137007766 GCGGCAACCGCAGTGACCACAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1062532413_1062532414 -5 Left 1062532413 9:137007726-137007748 CCTTTGGCACAATTAGGGGCGGC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1062532414 9:137007744-137007766 GCGGCAACCGCAGTGACCACAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1062532408_1062532414 4 Left 1062532408 9:137007717-137007739 CCGGGTCAGCCTTTGGCACAATT 0: 1
1: 0
2: 0
3: 17
4: 108
Right 1062532414 9:137007744-137007766 GCGGCAACCGCAGTGACCACAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1062532407_1062532414 9 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532414 9:137007744-137007766 GCGGCAACCGCAGTGACCACAGG 0: 1
1: 0
2: 1
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062532414 Original CRISPR GCGGCAACCGCAGTGACCAC AGG Exonic
903742960 1:25568947-25568969 ATGGCAGCAGCAGTGACCACAGG + Intergenic
903750522 1:25617836-25617858 GCGGCAGCCGCAGCCCCCACGGG - Exonic
906305430 1:44715427-44715449 GAGGAAACCTCAGTGATCACTGG - Intronic
907621688 1:55987724-55987746 GTGGAAACCACAGTGCCCACAGG + Intergenic
924832772 1:247615072-247615094 AGGGCAGCCCCAGTGACCACAGG - Intergenic
1063402523 10:5760319-5760341 GCGCCAACAGCAGTGAGTACGGG - Intronic
1071298489 10:84239703-84239725 CAGGCAACCCCAGTGCCCACAGG + Intronic
1072714889 10:97744437-97744459 GGGGCCACAGCAGTGACCAAAGG + Intronic
1074719126 10:116249360-116249382 GCGACATCTGCAGTGACAACAGG - Intronic
1075960453 10:126563429-126563451 GCTGCACACCCAGTGACCACAGG - Intronic
1076738462 10:132468939-132468961 GCTGCAACAGCCGTGGCCACGGG - Intergenic
1077263404 11:1635741-1635763 GCAGCAACCGTAGTGACCACTGG - Intergenic
1082671590 11:56042207-56042229 GCTGCAATTACAGTGACCACTGG - Intergenic
1091400132 12:176319-176341 GCAGCCACCCCAGAGACCACAGG + Exonic
1092654897 12:10673975-10673997 TCGGAAACCGGAGTGACCAGAGG - Exonic
1097363886 12:58689697-58689719 GCGGTTACTGCAGTGACCTCAGG - Intronic
1103564719 12:121809945-121809967 CCGGCCACCGCAGTGACCGCGGG - Exonic
1104353902 12:128068291-128068313 GCCGCAAGCAAAGTGACCACTGG - Intergenic
1116370317 14:44122020-44122042 GTGGCAACCACAGGGACCAGTGG - Intergenic
1118616535 14:67577996-67578018 GAGGGAACAGCAGTGAGCACAGG - Intronic
1119205581 14:72791330-72791352 GAGGCAGCTGCAGTGACCAGGGG - Intronic
1125134744 15:36328593-36328615 GCGGCAACCGCAGAGCCCCAAGG + Intergenic
1129388530 15:75208833-75208855 GGGGCAGCCCCAGTGGCCACCGG + Intronic
1130939207 15:88493900-88493922 CCAGCAACCTCAGGGACCACTGG - Intergenic
1132942795 16:2516503-2516525 GTGGCAACAGCAGAGGCCACTGG - Intronic
1142211235 16:88809620-88809642 TGGGCAACTGCAGTGACCAGGGG - Exonic
1150839563 17:68595329-68595351 GTGGCAACAGCAGTGAGGACAGG + Intronic
1160692788 19:467477-467499 GCCGCCACTGCAGTGCCCACTGG - Intronic
1161622613 19:5306607-5306629 GAGGCAACCGAAGTGTCCACAGG - Intronic
1161697305 19:5776523-5776545 GGGGGAACAGCAGTGACCAGAGG + Intronic
1162545466 19:11326506-11326528 GCGGCCATGGCAGTGCCCACAGG + Intronic
1166076570 19:40417289-40417311 GTGGCCACCGCAGTAAACACAGG + Intergenic
1167048880 19:47067052-47067074 GCGACAAACCCAGTGACCCCCGG - Exonic
932409425 2:71536410-71536432 GCCGCAAGGGCAGCGACCACGGG + Intronic
941233906 2:162945049-162945071 GAGACCACTGCAGTGACCACAGG + Intergenic
941615676 2:167716083-167716105 GCGGTCACCGCAGTTAACACTGG + Intergenic
942837652 2:180319870-180319892 GTGGCAACAGCAGTCAACACTGG - Intergenic
1175810031 20:61852930-61852952 GCTGCACCCGCAGAGCCCACAGG - Intronic
1176247012 20:64102237-64102259 GCGGGAACCGCGGTGACTAGCGG + Intergenic
1178677417 21:34642913-34642935 GAGACAACCACAGTGACCACAGG + Intergenic
1179804797 21:43830449-43830471 GCGGCGACGGCAGTGACAAGCGG - Intergenic
1185310555 22:50151921-50151943 GCGGCTGCCACAGTGACCCCAGG + Intronic
953055572 3:39384443-39384465 GCGGCAGCTGCAGTGGCCTCAGG - Intronic
958974770 3:100655025-100655047 GCGGCAATCGCAGTGCACATGGG - Exonic
959989583 3:112616132-112616154 GTGGCAACCCCAGTGTCCATGGG - Intronic
961713993 3:128846562-128846584 GGGGGAACCGCAGTGCCCAGTGG + Intergenic
968790103 4:2653987-2654009 GGGGCAACTGCAGTGACCCCTGG + Intronic
971220076 4:24697214-24697236 CAGGCAGACGCAGTGACCACGGG + Intergenic
986340837 5:6788106-6788128 GCTGCAACCTCAGTGTCCTCAGG + Intergenic
986805493 5:11305033-11305055 GATGCAAGCGCAGTGACCACAGG - Intronic
999443212 5:151619124-151619146 GAGCCAATCACAGTGACCACAGG + Intergenic
1001499470 5:172218307-172218329 GCAGCAAAAGCAGTGATCACTGG + Intronic
1004640294 6:17508624-17508646 GCAGCAACAGAAGTGACCATTGG + Intronic
1008389057 6:50928265-50928287 GTAGCAACAGCAGTGACAACAGG - Intergenic
1008881940 6:56388595-56388617 GCTGCAGCTGCAGTGACTACAGG + Intronic
1009793032 6:68428544-68428566 GTGGCAACAGCAGTGACATCAGG + Intergenic
1014116841 6:117675858-117675880 GCAGGAACCGCCGTCACCACCGG + Exonic
1017037340 6:150278766-150278788 GCAGCAACAGCCGTGACCACAGG + Intergenic
1018360932 6:163067245-163067267 GCAGCAACAGCATCGACCACGGG - Intronic
1019435816 7:1021641-1021663 GCTGCCACCGCAGTGCCCTCTGG + Intronic
1019523649 7:1471310-1471332 GCGGCAACGGCAGGGACCCTAGG + Intronic
1019730307 7:2626130-2626152 GCGGAGACTGCAGTGATCACAGG - Intergenic
1022490663 7:30815321-30815343 GAGGCAGCCTCAGAGACCACTGG + Intronic
1033837285 7:145330840-145330862 GAGGCATCAGCAGTGAACACTGG - Intergenic
1035040273 7:155921845-155921867 ATGGCAGCCGCAGCGACCACGGG - Intergenic
1037354101 8:17998930-17998952 GTGGCTACCACTGTGACCACCGG + Intronic
1040831316 8:51680660-51680682 GAGGCCACAGCAGTGACCATGGG + Intronic
1049322696 8:142005456-142005478 CCAGCAACCACAGGGACCACTGG - Intergenic
1057221128 9:93258550-93258572 GCAGCAGGAGCAGTGACCACAGG - Intronic
1057489207 9:95508623-95508645 GCGGCGGCCGCAGAGACCTCGGG - Exonic
1058699571 9:107589362-107589384 GGGCCAGCAGCAGTGACCACGGG - Intergenic
1059094745 9:111400216-111400238 GAAACAACTGCAGTGACCACAGG + Intronic
1062532414 9:137007744-137007766 GCGGCAACCGCAGTGACCACAGG + Exonic
1062579208 9:137222105-137222127 GCGGCGGCCGCAGCGACCTCAGG + Intergenic
1187205131 X:17174778-17174800 GCGGCAGCAGCAGTGACAGCAGG - Intergenic
1187332661 X:18354747-18354769 GCGGCAACCGCAGGGCACGCGGG - Intergenic
1190099710 X:47513274-47513296 GCAGGAACCGCCGTCACCACCGG - Intergenic
1192185771 X:68945993-68946015 GCGGCAGCCGGGGTGACAACAGG - Intergenic
1194616719 X:96112895-96112917 GCAGTAACAGCAGTGACCAGTGG - Intergenic