ID: 1062532415

View in Genome Browser
Species Human (GRCh38)
Location 9:137007745-137007767
Sequence CGGCAACCGCAGTGACCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062532413_1062532415 -4 Left 1062532413 9:137007726-137007748 CCTTTGGCACAATTAGGGGCGGC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1062532415 9:137007745-137007767 CGGCAACCGCAGTGACCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1062532406_1062532415 11 Left 1062532406 9:137007711-137007733 CCCGGGCCGGGTCAGCCTTTGGC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1062532415 9:137007745-137007767 CGGCAACCGCAGTGACCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1062532408_1062532415 5 Left 1062532408 9:137007717-137007739 CCGGGTCAGCCTTTGGCACAATT 0: 1
1: 0
2: 0
3: 17
4: 108
Right 1062532415 9:137007745-137007767 CGGCAACCGCAGTGACCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1062532407_1062532415 10 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532415 9:137007745-137007767 CGGCAACCGCAGTGACCACAGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062532415 Original CRISPR CGGCAACCGCAGTGACCACA GGG Exonic
904238219 1:29127564-29127586 CTGCCACCCCAGTGACCCCAGGG - Intergenic
905249684 1:36639902-36639924 CTGCAACCCCAGTGACCAGCTGG - Intergenic
915320517 1:155053507-155053529 TGGCAATAACAGTGACCACATGG + Intronic
915600541 1:156920580-156920602 GGGCAACCGCAGAGAGCACGCGG - Intergenic
915947498 1:160164277-160164299 CGGCCACCACAGTGATCAGATGG - Exonic
1072714890 10:97744438-97744460 GGGCCACAGCAGTGACCAAAGGG + Intronic
1074719125 10:116249359-116249381 CGACATCTGCAGTGACAACAGGG - Intronic
1076480209 10:130779927-130779949 CGGCAAGCAGCGTGACCACAGGG - Intergenic
1076980766 11:203552-203574 TGGCACCTGCAGTGACCAGATGG + Exonic
1077263403 11:1635740-1635762 CAGCAACCGTAGTGACCACTGGG - Intergenic
1078730925 11:13973317-13973339 TGGAAGCCCCAGTGACCACAGGG + Intronic
1078758398 11:14232871-14232893 CGGCGGCAGCAGTGAGCACATGG + Intronic
1081995777 11:47363073-47363095 CTTCAACTGCAGTGACAACATGG - Intronic
1082677274 11:56120990-56121012 CGGCAGCCACTGTGACCATAAGG - Intergenic
1087705686 11:101488987-101489009 TGGCAACAGCAAGGACCACAAGG + Exonic
1090744666 11:129696241-129696263 AGGCAACCCCTCTGACCACAAGG - Intergenic
1113338135 13:109396419-109396441 AGGCCACTGCTGTGACCACAGGG + Intergenic
1114401249 14:22412966-22412988 CAGCAGCTGCTGTGACCACAAGG - Intergenic
1122850982 14:104530821-104530843 CAGCAACCCAGGTGACCACACGG - Intronic
1122974525 14:105165641-105165663 GGTCAACAGCAGAGACCACAAGG + Intronic
1124077849 15:26462493-26462515 CAGCAACAGCAGTGGCAACACGG - Intergenic
1125134745 15:36328594-36328616 CGGCAACCGCAGAGCCCCAAGGG + Intergenic
1130939206 15:88493899-88493921 CAGCAACCTCAGGGACCACTGGG - Intergenic
1132582627 16:692326-692348 TGGAAACAGCAGTGACTACATGG - Intronic
1132899112 16:2243867-2243889 GGGTACCTGCAGTGACCACAGGG - Intronic
1136269005 16:29137563-29137585 TGGTGACAGCAGTGACCACATGG - Intergenic
1142072311 16:88097931-88097953 TGGTGACAGCAGTGACCACATGG - Intronic
1143189967 17:5033861-5033883 CGGCAGCTGAAGTGACCAGAAGG + Exonic
1143462434 17:7112560-7112582 CTGCAACTCCAGTGCCCACACGG - Intronic
1143962183 17:10729973-10729995 CGGCCACGGCAGTGTCCCCAAGG - Exonic
1144408076 17:14972168-14972190 CTGCAACAGATGTGACCACAGGG - Intergenic
1152647680 17:81477271-81477293 CCTCAACCTCAGAGACCACAGGG - Intergenic
1154473398 18:14726245-14726267 TGGCCACCACAGTGACCAAAAGG + Intergenic
1157220474 18:45825582-45825604 CGGCTCCCGCAGAGCCCACAGGG + Exonic
1160989482 19:1854611-1854633 CTTCACCCGCAGTGACCACCTGG - Exonic
1161622612 19:5306606-5306628 AGGCAACCGAAGTGTCCACAGGG - Intronic
924986920 2:280483-280505 CTGCAACCTCAGTGTTCACAGGG + Intronic
925186074 2:1847321-1847343 CGGGAACCGTAGAGGCCACAGGG + Intronic
936897604 2:117445923-117445945 CAGCAAGGGCAGTGACCTCATGG + Intergenic
945542426 2:211105369-211105391 CAGCAAGTGCAGGGACCACAGGG - Intergenic
947141999 2:227027973-227027995 CCGGGACCGCAGGGACCACATGG - Exonic
948870009 2:240793078-240793100 CAGCAGCCCCAGGGACCACACGG + Intronic
1175810030 20:61852929-61852951 CTGCACCCGCAGAGCCCACAGGG - Intronic
1176193043 20:63822628-63822650 CAGGAACAGCACTGACCACACGG + Intronic
1176801087 21:13431621-13431643 TGGCCACCACAGTGACCAAAAGG - Intergenic
1179197884 21:39183132-39183154 CGGCAACCGCGGGGGCCACTCGG + Intronic
950549563 3:13657997-13658019 CGTCAACCCCAGCGACCACACGG + Intergenic
952374325 3:32752887-32752909 CGGCAGCAGCAGTGACTACGAGG + Intronic
954307660 3:49738249-49738271 AGGCAGTGGCAGTGACCACAAGG - Exonic
956289022 3:67642246-67642268 GGGCAACAGCTGTGACAACAAGG + Intronic
956316557 3:67943955-67943977 AGGGAACCACAGTGTCCACATGG + Intergenic
962407690 3:135113995-135114017 CTGCAACCAAAGTGAACACAAGG - Intronic
969586367 4:8096543-8096565 CGGCACACGCTGTAACCACAGGG + Intronic
984428580 4:179619754-179619776 TGGTAAGCACAGTGACCACATGG + Intergenic
993604473 5:89971386-89971408 CGCCAACCGCAGAGATCACCAGG - Intergenic
996048841 5:118909286-118909308 GGGCATCTGCAGTGACCCCAAGG - Intronic
996544940 5:124668323-124668345 CTGCAACCTCAGTCACCTCAAGG - Intronic
999443213 5:151619125-151619147 AGCCAATCACAGTGACCACAGGG + Intergenic
1008389056 6:50928264-50928286 TAGCAACAGCAGTGACAACAGGG - Intergenic
1019074476 6:169376860-169376882 AGGTAACCTCAGTGTCCACATGG + Intergenic
1019074487 6:169376907-169376929 AGGTAACCTCAGTGTCCACATGG + Intergenic
1019074551 6:169377234-169377256 AGGTAACCTCAGTGTCCACATGG + Intergenic
1019074615 6:169377561-169377583 AGGTAACCTCAGTGTCCACATGG + Intergenic
1036796149 8:11758032-11758054 GGGCAACCACAGTATCCACAGGG + Intronic
1039549286 8:38431186-38431208 CGGCTGCCCCAGTGGCCACAGGG + Intronic
1044414983 8:91927129-91927151 CTGCAACCCCAGTGACTACCAGG - Intergenic
1049852107 8:144838256-144838278 GGGCCACCCCAGTGACCTCATGG + Intronic
1049915685 9:316013-316035 GGCCAACCGCCGTAACCACAAGG + Intronic
1058578567 9:106430306-106430328 CAGGAACAGCAGTTACCACAAGG - Intergenic
1062532415 9:137007745-137007767 CGGCAACCGCAGTGACCACAGGG + Exonic
1192185770 X:68945992-68946014 CGGCAGCCGGGGTGACAACAGGG - Intergenic
1196679118 X:118452849-118452871 CGGCAAGCACATGGACCACATGG - Intergenic