ID: 1062532416

View in Genome Browser
Species Human (GRCh38)
Location 9:137007750-137007772
Sequence ACCGCAGTGACCACAGGGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062532413_1062532416 1 Left 1062532413 9:137007726-137007748 CCTTTGGCACAATTAGGGGCGGC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1062532416 9:137007750-137007772 ACCGCAGTGACCACAGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 216
1062532406_1062532416 16 Left 1062532406 9:137007711-137007733 CCCGGGCCGGGTCAGCCTTTGGC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1062532416 9:137007750-137007772 ACCGCAGTGACCACAGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 216
1062532408_1062532416 10 Left 1062532408 9:137007717-137007739 CCGGGTCAGCCTTTGGCACAATT 0: 1
1: 0
2: 0
3: 17
4: 108
Right 1062532416 9:137007750-137007772 ACCGCAGTGACCACAGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 216
1062532407_1062532416 15 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532416 9:137007750-137007772 ACCGCAGTGACCACAGGGCATGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062532416 Original CRISPR ACCGCAGTGACCACAGGGCA TGG Exonic
900116952 1:1033062-1033084 GCCGCAGTGACGTCAGGGCCCGG + Intronic
900127417 1:1074660-1074682 GCAGCAGTGAGCAAAGGGCAGGG - Intergenic
900147919 1:1166475-1166497 ACCGCAGGGACGGCTGGGCAGGG + Intergenic
900954627 1:5878885-5878907 AGGGCACTGACCCCAGGGCAGGG + Intronic
901958659 1:12807470-12807492 CCCGCTGTGACCTCAGGGCATGG + Intergenic
901987977 1:13091243-13091265 CCCGCTGTGACCTCAGGGCATGG - Intergenic
901993835 1:13135524-13135546 CCCGCTGTGACCTCAGGGCATGG + Intergenic
902331717 1:15734175-15734197 TCCGCAGAGCCCACAGGGCTCGG - Exonic
903070209 1:20723492-20723514 ACCTCAGTGACCTCAGGCCTGGG - Intronic
903858416 1:26350940-26350962 ACTGCTGTGGCCACAGGGAAGGG - Intronic
904324812 1:29721473-29721495 AGCACAGTGACAACAGAGCAGGG - Intergenic
904425865 1:30422566-30422588 CCTGCAGTGCCCTCAGGGCAGGG + Intergenic
904434205 1:30483760-30483782 AGCACAGTGACAACAGAGCAGGG + Intergenic
906646388 1:47478348-47478370 ACCGCAGAGGCCACAGGTTACGG - Intergenic
914305648 1:146414149-146414171 ACAGTGGTGACCACAAGGCAGGG + Intergenic
918441183 1:184568679-184568701 ACAGCAGTCACCCCAGTGCATGG - Intronic
923048123 1:230370177-230370199 ACTGCAGTCAAGACAGGGCAGGG + Intronic
1063243479 10:4194637-4194659 GCCACTGAGACCACAGGGCATGG - Intergenic
1067351157 10:45476271-45476293 AACTCAGTGAACACTGGGCATGG + Intronic
1069578464 10:69547374-69547396 CCAGCAGTGAGCACAGGGCCTGG - Intergenic
1069620315 10:69833462-69833484 ACGGCACTGAACACAGGGCCTGG - Intronic
1069675947 10:70247846-70247868 CCTTCAGTGACCACAGTGCAGGG + Exonic
1070670310 10:78373018-78373040 ACAGCAGTGACATCAGAGCACGG - Intergenic
1070892586 10:79952638-79952660 ACTGCAGCAACCACAGGGGACGG - Intronic
1072548925 10:96462190-96462212 ACCACAGTGACCACAGGCCAAGG - Intronic
1072850295 10:98883268-98883290 ACCTAGGTGACCACAAGGCATGG + Intronic
1076201636 10:128563611-128563633 ACCCCATTCACCACAGTGCAGGG + Intergenic
1076522607 10:131090462-131090484 TTCAAAGTGACCACAGGGCAGGG - Intergenic
1076847199 10:133075146-133075168 CCTGCTGTGACCACAGGCCAGGG - Intronic
1077047661 11:553519-553541 GCTGCAGTGGCCTCAGGGCAGGG + Intronic
1077295148 11:1823046-1823068 TGCCCAGTGCCCACAGGGCAGGG - Intergenic
1078758400 11:14232876-14232898 GCAGCAGTGAGCACATGGCAGGG + Intronic
1080741468 11:35068511-35068533 ACAGAAGTCTCCACAGGGCATGG + Intergenic
1081996950 11:47371868-47371890 AGGCCAGTGAGCACAGGGCAGGG - Intronic
1085296539 11:75434751-75434773 ACATCAGTGGCCACAGGGCAGGG - Exonic
1085324051 11:75593157-75593179 ACTGAAGTGTCCAGAGGGCAGGG + Intronic
1087887250 11:103495151-103495173 ACCTGAGTGACGAGAGGGCAGGG + Intergenic
1088565703 11:111170474-111170496 TTCGCACTGACCACAGGGCCTGG + Intergenic
1089186080 11:116615523-116615545 TCTGCAGTGACCACAAGGCTGGG - Intergenic
1089200944 11:116724460-116724482 AGCCCAGTGTCCTCAGGGCAGGG - Intergenic
1089468897 11:118705201-118705223 ACCACAGCAACCACAGGGCATGG - Intergenic
1090252957 11:125263984-125264006 ATCCCAGTGACCTCAGGGGATGG + Intronic
1091301319 11:134509922-134509944 ACTGCAGTCTCCACAGGGCCTGG - Intergenic
1092077180 12:5683778-5683800 AACTCAGTGAGGACAGGGCAGGG + Intronic
1092182135 12:6453157-6453179 CCAGCAGTGAGGACAGGGCAAGG + Exonic
1092185357 12:6475100-6475122 GCCGCAGAGAGCACAGGGCTGGG + Intergenic
1092882658 12:12900069-12900091 ACAGCACTGACCACTGTGCAGGG - Intronic
1093619883 12:21276691-21276713 CCAGCAGTGGCCACATGGCATGG + Intronic
1096194717 12:49642501-49642523 ACCGCCATGAGCACAGGGCAGGG - Exonic
1096654311 12:53079185-53079207 AGCCCAGTGACCAGAGCGCAGGG + Intronic
1097007499 12:55929624-55929646 ACCGCAATGAACAAAGGGAAAGG - Intronic
1097084075 12:56454598-56454620 ATCGCAGTTCCCACATGGCAGGG + Exonic
1100981761 12:100167585-100167607 ACAGCAGTTACCGCAGGCCATGG - Intergenic
1101329831 12:103748806-103748828 AGCACAGAGGCCACAGGGCATGG + Intronic
1102012153 12:109625499-109625521 CCCTCAGTGACCACAGACCAGGG + Intergenic
1103919461 12:124391946-124391968 ACTGCGGTGGACACAGGGCATGG - Intronic
1104288417 12:127446672-127446694 ACCGCAGTTAGCACAGGGGTTGG + Intergenic
1105707054 13:22974311-22974333 ACTCCGGTGACCACACGGCAGGG - Intergenic
1109671817 13:65618548-65618570 ACAGCAGTGAGGAGAGGGCATGG - Intergenic
1110063169 13:71067328-71067350 GCTGCAGTGACCACAGGCCTAGG - Intergenic
1113924039 13:113930476-113930498 AGTGCAGTGGCCACAGGGCAAGG + Intergenic
1118982003 14:70724731-70724753 ACTTCAGTGAGCGCAGGGCAAGG + Intronic
1119163978 14:72477079-72477101 ACAGCAGTTACCCCAAGGCATGG - Intronic
1121111171 14:91314093-91314115 CCCGCAGCGACCACATGGCTCGG + Exonic
1121422691 14:93826476-93826498 CCCACGGTGACCACAGAGCAGGG + Intergenic
1122122294 14:99561016-99561038 CCCTCAGTCTCCACAGGGCAGGG + Intronic
1122850980 14:104530816-104530838 ACCCAGGTGACCACACGGCAGGG - Intronic
1124019032 15:25903124-25903146 ACTGTGGTGACCACAGGCCAGGG + Intergenic
1124077847 15:26462488-26462510 ACAGCAGTGGCAACACGGCAGGG - Intergenic
1125738363 15:41944021-41944043 AGGGCAGTGACTACAGGGAAAGG - Intronic
1125966479 15:43879522-43879544 ACTGCTGTGACCCCCGGGCAAGG - Intronic
1126979952 15:54229203-54229225 TTGGCAGTGACCACATGGCATGG - Intronic
1127722323 15:61715284-61715306 CATGAAGTGACCACAGGGCAGGG + Intergenic
1129187902 15:73921691-73921713 ACTGCAGTCAGCACAGGGCCTGG + Intergenic
1130012626 15:80163440-80163462 ATCCCAGTGGCCAAAGGGCAGGG + Intronic
1131179314 15:90229209-90229231 ACCTCAGGGACCAGAGGGCTAGG + Exonic
1131315243 15:91329809-91329831 CCAGCAGTGACCACATGGCGTGG - Intergenic
1132733414 16:1374296-1374318 CCAGCAGGGACGACAGGGCAGGG - Intronic
1133009929 16:2905262-2905284 GCCGCAGTGAGCCCAGGGCACGG + Intergenic
1133620562 16:7522078-7522100 TCCTCAGTGACCCCAGGGCTGGG - Intronic
1134630216 16:15750771-15750793 ACAGCAGTGTCCCCAGGGCCTGG - Intronic
1135995040 16:27241402-27241424 ACAGCACTGAGGACAGGGCAGGG + Intronic
1136041788 16:27585056-27585078 ACTCCTGTGACCACAGGGCTGGG + Intronic
1136451877 16:30358275-30358297 TCAGCAGTGACCACAGGCCCTGG + Exonic
1136517641 16:30777588-30777610 ACCTCAGTGTCCCCAGGGCTTGG + Intergenic
1138448214 16:57077864-57077886 CCCGCAGTGGGCACAGGGCAGGG + Intronic
1138585366 16:57966336-57966358 TCAGCACTGACCACAGGGCCTGG + Intronic
1138874112 16:60928445-60928467 ACTGCAGTGACAACTGTGCAAGG - Intergenic
1142291319 16:89194786-89194808 ACCGCCGTGGCCACAGCCCAGGG - Intronic
1143811506 17:9475507-9475529 ACTGCAGTCTACACAGGGCAGGG - Intronic
1144571023 17:16399091-16399113 GCCCCAGTGAGCTCAGGGCATGG - Intergenic
1144864172 17:18324242-18324264 ACCTCAGTCACCACAGCTCACGG + Intergenic
1144955990 17:19019160-19019182 TCCGCAGAGACCCCAGGGCAGGG + Intronic
1145363142 17:22228697-22228719 GCCCCAGTGAGCTCAGGGCACGG - Intergenic
1145937842 17:28725733-28725755 GCCGCAGTGGCCCCAGGGGAGGG - Intronic
1145992953 17:29090176-29090198 ACCACAGTGACCAGAAGGCAAGG + Intronic
1146526214 17:33569177-33569199 ACGGCATTGACCACAGTGCCAGG - Intronic
1147667786 17:42159770-42159792 ACCGCAGTGCCCATTGGGCTGGG - Exonic
1150821241 17:68436041-68436063 GCCTCAGAGACCAGAGGGCAGGG + Intronic
1152291046 17:79440495-79440517 AAGCCGGTGACCACAGGGCAGGG + Intronic
1152633632 17:81421543-81421565 ACAGTAGTGACCACCTGGCAGGG + Intronic
1153985838 18:10350347-10350369 CCCGGGGTGGCCACAGGGCAGGG - Intergenic
1155173258 18:23282660-23282682 AACCCAGTGACCCCAGGGTAGGG + Intronic
1158068849 18:53446346-53446368 ACCACAGTGACCACAAGCCCTGG - Intronic
1158311887 18:56168091-56168113 ATAGCAGTGACCCCAGGTCAAGG + Intergenic
1160386574 18:78500518-78500540 ACCCCAGGGACAACTGGGCAGGG + Intergenic
1162351831 19:10155105-10155127 CCTACAGTGGCCACAGGGCATGG + Intronic
1165095209 19:33406484-33406506 ACCGCAGAGTGCTCAGGGCAGGG + Intronic
1166674571 19:44732196-44732218 ACAGCAGAGACCTCTGGGCACGG - Intergenic
1168650197 19:58087568-58087590 AGCGCGGTGGCCACAGGGCTTGG + Intronic
925038092 2:707212-707234 ACTGCAGTGACCCCAGGAGAGGG - Intergenic
926005846 2:9373080-9373102 ACCGCAGTGAGCTCAGTGCACGG + Intronic
928246916 2:29638482-29638504 GTGGCAATGACCACAGGGCAAGG + Intronic
929216647 2:39421271-39421293 AACACAGTGACTACAAGGCATGG + Intronic
931161070 2:59691286-59691308 CCAGCAGATACCACAGGGCAAGG + Intergenic
932493352 2:72134838-72134860 GCTGCAGTGCACACAGGGCAAGG - Exonic
933635426 2:84703159-84703181 ACTGCTGTGGCCAGAGGGCATGG + Intronic
938365335 2:130729170-130729192 GCTGTAGTGCCCACAGGGCAAGG - Exonic
940004497 2:148998609-148998631 AGGGCAGTGCCCACAGGGCAAGG - Intronic
942010399 2:171756617-171756639 GCTGCAGTAACCACATGGCATGG - Intergenic
942138717 2:172955852-172955874 GTCGCAGTGGCCACAGGGCTGGG - Intronic
945261196 2:207844801-207844823 ACTGCTGTGACAACAGGGTAGGG + Intronic
945658989 2:212660904-212660926 ATAGAAGTGACCACCGGGCAGGG + Intergenic
947640306 2:231703999-231704021 ACTGAAGTGCCCACAGGGCCAGG + Intergenic
948756187 2:240160964-240160986 ACCACAGTGACCAGGGGGCAGGG + Intergenic
1171032480 20:21690184-21690206 ACCTCAGGGAGGACAGGGCAGGG + Intergenic
1171388549 20:24786510-24786532 ATCCCAGTGACCACAGAGCTAGG + Intergenic
1172280966 20:33707860-33707882 ACCGCAGTGAGCAGCGGGAACGG + Exonic
1175872363 20:62214511-62214533 ACTGCAGTGACCAGAGGGGAGGG - Intergenic
1175928137 20:62480822-62480844 GCCCCAGAGACCCCAGGGCAGGG + Intergenic
1176336309 21:5602861-5602883 AGCACTGTGACCATAGGGCAGGG - Intergenic
1176336429 21:5603686-5603708 AGCCCAGTGACCAAAGGGCTGGG - Intergenic
1176336451 21:5603827-5603849 AGCCCAGTGACCAAAGGGCTGGG - Intergenic
1176391306 21:6217121-6217143 AGCCCAGTGACCAAAGGGCTGGG + Intergenic
1176391328 21:6217262-6217284 AGCCCAGTGACCAAAGGGCTGGG + Intergenic
1176391448 21:6218087-6218109 AGCACTGTGACCATAGGGCAGGG + Intergenic
1176469971 21:7098087-7098109 AGCACTGTGACCATAGGGCAGGG - Intergenic
1176470091 21:7098912-7098934 AGCCCAGTGACCAAAGGGCTGGG - Intergenic
1176470113 21:7099053-7099075 AGCCCAGTGACCAAAGGGCTGGG - Intergenic
1176493532 21:7479865-7479887 AGCACTGTGACCATAGGGCAGGG - Intergenic
1176493652 21:7480690-7480712 AGCCCAGTGACCAAAGGGCTGGG - Intergenic
1176493674 21:7480831-7480853 AGCCCAGTGACCAAAGGGCTGGG - Intergenic
1176506968 21:7657552-7657574 AGCCCAGTGACCAAAGGGCTGGG + Intergenic
1176506990 21:7657693-7657715 AGCCCAGTGACCAAAGGGCTGGG + Intergenic
1176507110 21:7658518-7658540 AGCACTGTGACCATAGGGCAGGG + Intergenic
1179906917 21:44427327-44427349 ACGGCAGGGACCATGGGGCAGGG - Intronic
1180252441 21:46598103-46598125 AGCGCAGTGAACACCGGGAATGG + Intergenic
1180842948 22:18967737-18967759 ACAGCTGTGACCTCAGGGCTGGG - Intergenic
1181035415 22:20167713-20167735 ATGGCAGTGACCACGGGGCAGGG + Intergenic
1181035879 22:20169539-20169561 AGCCCAGTGACCACAGGACGAGG - Intergenic
1181459658 22:23078628-23078650 TCCCCAGGGACCACAGGGAATGG + Intronic
1183181917 22:36266024-36266046 AGAACTGTGACCACAGGGCAGGG + Exonic
1183743457 22:39680487-39680509 TCTGCAGCCACCACAGGGCAGGG - Intronic
1184244355 22:43228400-43228422 GCCCCAGTGACCACATGGAAAGG - Intronic
1184738097 22:46410847-46410869 AGCGCAGGGAGCACAGGTCAAGG + Intronic
1184861904 22:47177085-47177107 ACAGCAGCCACCACAGGTCAGGG - Intergenic
1185254140 22:49822849-49822871 AACGCAATGACCACACAGCACGG + Intronic
954289591 3:49642622-49642644 ACCGCAGTGCCCGCTGGGCTTGG + Exonic
954387413 3:50251547-50251569 AGCGCAGTGAGCAGAGGGCGGGG + Intronic
954729206 3:52643552-52643574 ACTGCAGTGACCAGAGGACCTGG + Intronic
955506289 3:59636327-59636349 ACTGCTGTGACCACAGGTGAGGG + Intergenic
962150819 3:132891638-132891660 ACCCAAGTGAACAAAGGGCAGGG + Intergenic
962374969 3:134851645-134851667 GCCACAGTGTCCACAGGTCAGGG - Intronic
965811059 3:172592224-172592246 ACCACAGTGACCACATGGAGAGG - Intergenic
967015640 3:185479242-185479264 AGCCCAGTGTCCACTGGGCATGG - Intronic
968047659 3:195632896-195632918 GCTGTGGTGACCACAGGGCAGGG + Intergenic
968070035 3:195779059-195779081 TCCTCAGTGTCCACAGGTCACGG - Exonic
968306953 3:197657028-197657050 GCTGTGGTGACCACAGGGCAGGG - Intergenic
968456122 4:700898-700920 ACACCAGAGTCCACAGGGCAGGG - Intergenic
969056705 4:4407045-4407067 GCCGCAGTGCCCACAGGGAAAGG - Intronic
969337961 4:6522658-6522680 CCAGAAGTGGCCACAGGGCACGG + Intronic
980134912 4:128849461-128849483 AACGAAGTGACAAAAGGGCATGG + Intronic
981910937 4:149981261-149981283 ACTGCAGTGACCACATTGCGGGG - Intergenic
982176282 4:152708438-152708460 AGGGCAGTGACCACAAGCCAGGG - Intronic
985743953 5:1636268-1636290 GCTGTGGTGACCACAGGGCAGGG - Intergenic
985774306 5:1832830-1832852 GCCACAGAGCCCACAGGGCATGG + Intergenic
985851494 5:2391860-2391882 ATGGCAGTCACCACAGGGCCAGG - Intergenic
985851523 5:2391990-2392012 ACAGAAGTCACCACAGGGCCAGG - Intergenic
986108425 5:4685304-4685326 TGGGAAGTGACCACAGGGCATGG - Intergenic
987710530 5:21497262-21497284 ACTGCAGTGGGCGCAGGGCAGGG - Intergenic
991760860 5:69916321-69916343 ACTGCAGTGGGCGCAGGGCAGGG - Intergenic
991786470 5:70201780-70201802 ACTGCAGTGGGCGCAGGGCAGGG + Intergenic
991840089 5:70791372-70791394 ACTGCAGTGGGCGCAGGGCAGGG - Intergenic
991878913 5:71202165-71202187 ACTGCAGTGGGCGCAGGGCAGGG + Intergenic
992548723 5:77841585-77841607 ACCCCAGTGACCATATGACAAGG - Intronic
998216509 5:140241748-140241770 GCTGCAGTGACCCCAGGGCCTGG + Intronic
1001553923 5:172623560-172623582 ACCAAAGTGAACACAGGCCAGGG + Intergenic
1002571254 5:180140509-180140531 ACCGCAGTGAGCACAGAGAGTGG - Intronic
1002878859 6:1234702-1234724 ACCTCAATGACCAGAGGGGAAGG + Intergenic
1003507503 6:6751794-6751816 AGCGCAGAGATCACAGGGCTGGG + Intergenic
1005547159 6:26883255-26883277 ACTGCAGTGGGCGCAGGGCAGGG + Intergenic
1005875832 6:30008920-30008942 ACCCCAGTAATCACAGGTCAGGG + Intergenic
1006980654 6:38145174-38145196 CCCCCAGTGGCCACAGGGAATGG - Intronic
1015074354 6:129136965-129136987 AACACTGTGACCACAGGTCACGG - Intronic
1019137279 6:169918177-169918199 ACCCCATAGACCACAGGGCTCGG - Intergenic
1019918502 7:4148606-4148628 ACCAAAGGGACCACAGGGCTTGG + Intronic
1020016292 7:4834032-4834054 GCCACAGTGTCCACAGGGCCGGG + Intronic
1022766530 7:33418555-33418577 AAAGCAATAACCACAGGGCATGG - Intronic
1031532936 7:122898615-122898637 ACTGAAGGTACCACAGGGCAGGG + Intergenic
1032425209 7:131817130-131817152 ATCACAGTGACCACATGGCCTGG - Intergenic
1032708637 7:134443566-134443588 AGGGCAGGGAGCACAGGGCAGGG + Intronic
1034126276 7:148674778-148674800 CTGGCAGTGGCCACAGGGCATGG + Intergenic
1034202710 7:149292605-149292627 ACCGCAGCTTCCACACGGCAGGG + Intronic
1034991214 7:155549139-155549161 CCCACAGTGACCACAGCACAGGG - Intergenic
1036048245 8:5167489-5167511 ACCCCAGTGCCAAAAGGGCAGGG + Intergenic
1037792460 8:21957771-21957793 ATCCCAGTGAGCACAGTGCATGG - Intronic
1040007675 8:42633912-42633934 ACCAGAGTGACCACAGGCAATGG - Intergenic
1044889058 8:96813082-96813104 CCCGCAGTGACAACAGGAAAAGG + Intronic
1045190302 8:99875526-99875548 TCTGCAGCCACCACAGGGCATGG - Exonic
1046564269 8:115878647-115878669 AACACAGAGCCCACAGGGCAAGG - Intergenic
1047170708 8:122489841-122489863 GCCGCAGGGCCCACAGGGCAGGG + Intergenic
1048931516 8:139319122-139319144 ACCTCAGCGGCCCCAGGGCATGG - Intergenic
1049915687 9:316018-316040 ACCGCCGTAACCACAAGGAATGG + Intronic
1051626510 9:19104049-19104071 ACCCCACTGACAACAGGGCCTGG + Intergenic
1054879158 9:70126708-70126730 CCCTCTGTGACCACAGTGCAAGG - Intronic
1057958116 9:99428031-99428053 TACACAGGGACCACAGGGCAGGG - Intergenic
1058191807 9:101925645-101925667 ACCACTGAAACCACAGGGCAGGG + Intergenic
1058271732 9:102981205-102981227 ACTGCAGAGAGCACAGGGCAGGG + Intergenic
1059094746 9:111400222-111400244 ACTGCAGTGACCACAGGCTTAGG + Intronic
1061245292 9:129398462-129398484 ACCGCAGTGAGGGCTGGGCAAGG + Intergenic
1062029154 9:134354242-134354264 GCCGCAGAGACCGCAGGGCCAGG - Intronic
1062255034 9:135616818-135616840 ATTGCAATGTCCACAGGGCATGG + Intergenic
1062445226 9:136590918-136590940 ACCACAGTGACCTCATGGCATGG + Intergenic
1062532416 9:137007750-137007772 ACCGCAGTGACCACAGGGCATGG + Exonic
1203425196 Un_GL000195v1:31075-31097 AGCCCAGTGACCAAAGGGCTGGG + Intergenic
1203425218 Un_GL000195v1:31216-31238 AGCCCAGTGACCAAAGGGCTGGG + Intergenic
1203425336 Un_GL000195v1:32041-32063 AGCACTGTGACCATAGGGCAGGG + Intergenic
1186634109 X:11383536-11383558 ATGGCAGAGACCACAGGCCAAGG - Intronic
1187074455 X:15920299-15920321 ACAGCAGTGATAACAGAGCATGG - Intergenic
1189196737 X:39159933-39159955 TCCCCAGTGAGCACAGGGCCTGG - Intergenic
1189257709 X:39653324-39653346 ACCGATAAGACCACAGGGCAGGG + Intergenic
1192215280 X:69153664-69153686 ACAGCAGTGAGCAAAGGGCCTGG + Intergenic
1196782527 X:119396293-119396315 ACCGTGGTTACCTCAGGGCATGG + Intergenic
1197138498 X:123090349-123090371 ACCCCAGAGACCTCAGGGTACGG - Intergenic
1197675683 X:129327450-129327472 ACAGCCTTGCCCACAGGGCAAGG + Intergenic
1199418549 X:147615866-147615888 ACCCCAGTGATCACAGGCTATGG + Intergenic
1200068509 X:153516682-153516704 ACAGCAGGGACCACAAAGCAGGG - Intergenic
1200176689 X:154122045-154122067 ACCCCTGGGTCCACAGGGCAGGG - Intergenic