ID: 1062532419

View in Genome Browser
Species Human (GRCh38)
Location 9:137007761-137007783
Sequence CACAGGGCATGGCCGAGTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062532408_1062532419 21 Left 1062532408 9:137007717-137007739 CCGGGTCAGCCTTTGGCACAATT 0: 1
1: 0
2: 0
3: 17
4: 108
Right 1062532419 9:137007761-137007783 CACAGGGCATGGCCGAGTACAGG 0: 1
1: 0
2: 2
3: 29
4: 250
1062532413_1062532419 12 Left 1062532413 9:137007726-137007748 CCTTTGGCACAATTAGGGGCGGC 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1062532419 9:137007761-137007783 CACAGGGCATGGCCGAGTACAGG 0: 1
1: 0
2: 2
3: 29
4: 250
1062532407_1062532419 26 Left 1062532407 9:137007712-137007734 CCGGGCCGGGTCAGCCTTTGGCA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1062532419 9:137007761-137007783 CACAGGGCATGGCCGAGTACAGG 0: 1
1: 0
2: 2
3: 29
4: 250
1062532406_1062532419 27 Left 1062532406 9:137007711-137007733 CCCGGGCCGGGTCAGCCTTTGGC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1062532419 9:137007761-137007783 CACAGGGCATGGCCGAGTACAGG 0: 1
1: 0
2: 2
3: 29
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062532419 Original CRISPR CACAGGGCATGGCCGAGTAC AGG Exonic
901719793 1:11187558-11187580 AACAGGCCATGGACAAGTACAGG + Intronic
902993311 1:20204779-20204801 CACCGCGCCTGGCCGAGTAAAGG - Intergenic
902998070 1:20243087-20243109 CACGGGGCAGGGCGGAGGACGGG - Intergenic
903063144 1:20684182-20684204 CACAGGCCAGGGCGGAGGACAGG - Intronic
903434357 1:23335395-23335417 AACAGGCCATGGACCAGTACGGG - Intronic
903850423 1:26302497-26302519 CACAGGGCCTGGCCCAGGATAGG + Intronic
906209975 1:44007339-44007361 CACAGGGCCTGGCAGAGCAGAGG + Intronic
906864097 1:49397156-49397178 CCCAGGCCATGGACCAGTACTGG - Intronic
906883032 1:49613403-49613425 AACAGGGAATGGCCTGGTACCGG - Intronic
907029853 1:51160297-51160319 CCCAGGCCATGGACCAGTACTGG + Intergenic
907278839 1:53331909-53331931 CAGAGGGCATGGCCTAGCAGAGG - Intergenic
908917374 1:69144966-69144988 CACAGAGCATAGCATAGTACAGG - Intergenic
911978448 1:104534220-104534242 AACAGGCCATGGGCGTGTACTGG + Intergenic
912547584 1:110462001-110462023 CACAGGTCAAGGCCGACTACTGG - Intergenic
913094134 1:115500340-115500362 AACAGGCCATGGACTAGTACTGG + Intergenic
913957447 1:143318624-143318646 CACAGGGCATGGCCAAAAACAGG + Intergenic
914051761 1:144143988-144144010 CACAGGGCATGGCCAAAAACAGG + Intergenic
914127436 1:144822553-144822575 CACAGGGCATGGCCAAAAACAGG - Intergenic
915067469 1:153238540-153238562 CACAGGGCCTGACCTAGGACTGG - Intergenic
917068976 1:171128359-171128381 CACAGGGGCTGGCCTGGTACCGG - Intergenic
917449366 1:175134265-175134287 CACTGCGCCTGGCCAAGTACAGG - Intronic
918019581 1:180673516-180673538 AACAGGCCATGGCCCAGTACTGG - Intronic
919852649 1:201683647-201683669 CCCAGGCCATGGACCAGTACTGG - Intronic
920078780 1:203356841-203356863 CACAGTGCTTGGCCAAGTGCTGG + Intergenic
920550384 1:206855682-206855704 CCCAGGCCATGGACCAGTACCGG - Intergenic
921055243 1:211538245-211538267 CACAGGGCAGGGCGTAGTGCTGG - Intergenic
921274044 1:213499665-213499687 CCCAGGCCATGGACCAGTACTGG - Intergenic
923687059 1:236160737-236160759 CACAGGGCCTGGCCAAGGGCAGG - Intronic
924100023 1:240593684-240593706 CACAGGGCCTAGCCTAGTCCTGG + Intronic
924930004 1:248722028-248722050 CACAGGACATGCCCAGGTACTGG + Intronic
1063113674 10:3057837-3057859 AACAGGGCATGGCCGGGAAAGGG + Intergenic
1065121464 10:22534472-22534494 AACAGGCCATGGACTAGTACCGG + Intergenic
1066961396 10:42230820-42230842 CACAGGGCATGGCCAAAAACAGG + Intergenic
1067199621 10:44156020-44156042 CCCAGGCCATGGACCAGTACTGG - Intergenic
1068602508 10:58970383-58970405 CACAGGCCATGGACTGGTACTGG + Intergenic
1072256921 10:93629897-93629919 AACAGGCCATGGGCCAGTACTGG + Intronic
1073232316 10:101982525-101982547 CCCAGGCCATGGACGAGTACTGG + Intronic
1074440365 10:113472372-113472394 CACAGAGCCTGGCAGAGGACAGG - Intergenic
1075224717 10:120617961-120617983 CACAGGGTCTGGCTGTGTACAGG + Intergenic
1075848274 10:125564797-125564819 CCCAGGCCATGGACCAGTACAGG - Intergenic
1076284948 10:129285732-129285754 AACAGGTCATGGACTAGTACTGG + Intergenic
1076606672 10:131694133-131694155 CACAGGTCATTGCAGAGTTCGGG - Intergenic
1078571819 11:12465117-12465139 AACAGGCCATGGACCAGTACTGG + Intronic
1083903664 11:65656151-65656173 CACATGGTGAGGCCGAGTACAGG + Intronic
1084316819 11:68350444-68350466 CACAGGGCATGGCCAAGGGAAGG - Intronic
1085306134 11:75487108-75487130 CACAGGGCAGGGCCGGGGATAGG - Intronic
1086926170 11:92642907-92642929 TACAGTGCATGGCAGAGTAAGGG - Intronic
1088818520 11:113437670-113437692 CACAGGGCATGCTCGAGTCTGGG + Intronic
1091095824 11:132821301-132821323 CACAAGGCAAGGCAGAGCACAGG + Intronic
1091748905 12:3010595-3010617 CACAGGGCAAGGCCGAGGGCCGG + Intronic
1092094900 12:5833571-5833593 AACAGGCCATGGACCAGTACCGG - Intronic
1092741624 12:11636016-11636038 AACAGGCCATGGTCCAGTACTGG - Intergenic
1093224499 12:16465414-16465436 AACAGGCCATGGACCAGTACCGG - Intronic
1093844763 12:23956325-23956347 AACAGGACATGGACCAGTACTGG - Intergenic
1094719136 12:33044495-33044517 CCCAGGCCATGGACCAGTACTGG - Intergenic
1096972948 12:55682077-55682099 CAAAGAGCATGGCTGAGAACAGG + Exonic
1097110335 12:56653227-56653249 AACAGGCCATGGACGGGTACTGG - Intergenic
1098144504 12:67484949-67484971 AACAGGCCATGGACCAGTACAGG - Intergenic
1099154581 12:79158498-79158520 TACAGGCCATGGACCAGTACTGG - Intronic
1100625576 12:96327975-96327997 AACAGGCCATGGACCAGTACTGG - Intronic
1101821232 12:108185726-108185748 TACAGGGAATGGCAGAGAACAGG - Intronic
1104682414 12:130760906-130760928 CACAGAGTAGGGCCGAGGACAGG - Intergenic
1105772894 13:23629822-23629844 GTCAGGGTATGGCCGAGGACAGG - Intronic
1105897236 13:24726619-24726641 CGCAGGGCATGGGCTAGGACTGG + Intergenic
1108588904 13:51895157-51895179 AACAGGCCATGGACAAGTACTGG + Intergenic
1109654188 13:65368011-65368033 AACAGGCCATGGACCAGTACTGG + Intergenic
1109654191 13:65368024-65368046 CATAGGCCATGGACCAGTACTGG - Intergenic
1112190693 13:97174649-97174671 CACAGAGCATGGCTGAAAACAGG + Intergenic
1112480768 13:99773336-99773358 CCCAGGCCATGGACCAGTACAGG + Intronic
1113300322 13:109012244-109012266 CACAGGCCGTGGACCAGTACTGG - Intronic
1113798827 13:113075936-113075958 CACAGAGCATTGCCGAGGGCAGG - Intronic
1114431741 14:22667228-22667250 AACAGGTCATGGACCAGTACTGG + Intergenic
1116855905 14:49952162-49952184 CAATGGGCAGGGCCAAGTACTGG + Intergenic
1119122220 14:72090275-72090297 CCCAGGCCATGGACCAGTACCGG + Intronic
1119128164 14:72147749-72147771 CAGAGGGCAAGGAAGAGTACAGG + Intronic
1120347397 14:83308320-83308342 AACAGGCCATGGACCAGTACTGG + Intergenic
1120347399 14:83308333-83308355 CTCAGGTCATGGACCAGTACTGG - Intergenic
1121063693 14:90940693-90940715 CCCAGGCCATGGACAAGTACTGG + Intronic
1121604573 14:95231066-95231088 CCCAGGCCATGGACCAGTACTGG + Intronic
1123443628 15:20306569-20306591 CACAGGGCATGGCCAAAAACAGG - Intergenic
1126118182 15:45227795-45227817 CCCAGGCCATGGACCAGTACTGG + Intergenic
1126511012 15:49474657-49474679 AACAGGCCATGGACCAGTACCGG - Intronic
1126599986 15:50418636-50418658 CACAGGACATGCCCAGGTACTGG - Intergenic
1127568231 15:60214473-60214495 AACAGGCCATGGACTAGTACTGG + Intergenic
1127707737 15:61563752-61563774 CAGAGGGCTTGGGTGAGTACAGG - Intergenic
1128183678 15:65626116-65626138 CACAGTGCCTGGCAGAGAACAGG - Intronic
1129336322 15:74854237-74854259 CACAGGGGAAGGCCCAGTGCAGG - Intronic
1129857604 15:78835784-78835806 CACAGGGCAAGGCAGAGTAGGGG - Intronic
1131349927 15:91690254-91690276 AACAGGCCAAGGACGAGTACTGG + Intergenic
1133317334 16:4892818-4892840 CACAGGGCAGTGGCGAGGACAGG - Intronic
1135868306 16:26125512-26125534 AACAGGACATGGACCAGTACTGG + Intronic
1135959752 16:26985820-26985842 CTCAGAGCATGGCCGAAAACAGG + Intergenic
1135976755 16:27113508-27113530 CACAGGTCAGGTCTGAGTACTGG - Intergenic
1136722585 16:32337328-32337350 CACAGGTCATGGCCAAAAACAGG + Intergenic
1136840908 16:33543321-33543343 CACAGGTCATGGCCAAAAACAGG + Intergenic
1138513948 16:57525682-57525704 CACAGTGCCTGGCCCAGAACAGG + Intronic
1138620597 16:58208012-58208034 AACAGGCCATGGACTAGTACTGG - Intergenic
1140239206 16:73185823-73185845 GACAGGCCATGGACCAGTACTGG - Intergenic
1141813741 16:86394848-86394870 CACCACGCCTGGCCGAGTACTGG - Intergenic
1141836517 16:86543750-86543772 CACAGGCCATGGACTAGTACTGG - Intronic
1203003846 16_KI270728v1_random:180436-180458 CACAGGTCATGGCCAAAAACAGG - Intergenic
1203135454 16_KI270728v1_random:1716843-1716865 CACAGGTCATGGCCAAAAACAGG - Intergenic
1203151073 16_KI270728v1_random:1843618-1843640 CACAGGTCATGGCCAAAAACAGG + Intergenic
1144077517 17:11732792-11732814 CACAGGGCATGGAGGGGAACAGG - Intronic
1147572763 17:41581562-41581584 CACAGGGCCTGGCATAGTGCTGG - Intergenic
1147610341 17:41798294-41798316 CACAGCGCATGGCCCTGTAGGGG + Intergenic
1147759194 17:42786679-42786701 CACCGTGCCTGGCCGAGTATGGG + Intronic
1148337356 17:46851083-46851105 CTCAGGGCAGGGCCGGGTCCTGG - Intronic
1151758491 17:76087981-76088003 CCCAGGGCCAGGCAGAGTACTGG - Intronic
1152154769 17:78625786-78625808 CTCAGTGCATGGCAGAGTGCAGG - Intergenic
1158745704 18:60197241-60197263 CACAGGGATTGGCTGAATACAGG + Intergenic
1159670898 18:71219416-71219438 AACAGGCCATGGACTAGTACTGG + Intergenic
1165124547 19:33584370-33584392 CCCAGGCCATGGACTAGTACTGG - Intergenic
1165235870 19:34421147-34421169 CCCAGGCCATGGACCAGTACTGG - Intronic
1165671129 19:37680330-37680352 CACAGGCCAAGGACCAGTACTGG + Intronic
1165770475 19:38376988-38377010 CACAGGGCCAGGCCCAGAACAGG + Intronic
1166939185 19:46352530-46352552 CACAGCGCCTGGCCGAGAAGTGG - Intronic
1202691157 1_KI270712v1_random:96412-96434 CACAGGGCATGGCCAAAAACAGG + Intergenic
925529310 2:4842008-4842030 AACAGGCCATGGACCAGTACTGG + Intergenic
925590971 2:5508971-5508993 AACAGGCCATGGACCAGTACTGG - Intergenic
925747864 2:7059425-7059447 CACGGGGCATGGCACAGAACAGG - Intronic
925811220 2:7702793-7702815 CTCAGGGCAGGGCAGAGCACGGG + Intergenic
926742757 2:16125998-16126020 CAGAGTGCATGGCCGAGGCCAGG - Intergenic
926995453 2:18730290-18730312 AACAGGCCATGGACCAGTACCGG - Intergenic
927132253 2:20070648-20070670 GACAGGCCATGGACCAGTACTGG + Intergenic
928306952 2:30178146-30178168 CACAGTCCATGGCAGGGTACAGG + Intergenic
928858036 2:35823696-35823718 CTCAGAGCATGGCCAAGAACAGG - Intergenic
929239892 2:39643239-39643261 CCCAGGCCATGGACCAGTACTGG + Intergenic
929761448 2:44810810-44810832 CCCAGGGGATGGCTGGGTACAGG + Intergenic
932259967 2:70318708-70318730 CACAGGGCATGGCCAAGGTTGGG + Intergenic
932540778 2:72649982-72650004 CACAGGCCACGGGCCAGTACCGG + Intronic
933955233 2:87357538-87357560 CACAGGGCATGGCCAAAAACAGG - Intergenic
934052307 2:88221063-88221085 CACAGGGCCTGGCAGCTTACAGG + Intergenic
934239423 2:90253752-90253774 CACAGGGCATGGCCAAAAACAGG - Intergenic
934273762 2:91562946-91562968 CACAGGGCATGGCCAAAAACAGG + Intergenic
934323528 2:91986289-91986311 CACAGGGCATGGCCAAAAACAGG - Intergenic
936098338 2:109551960-109551982 AACAGGCCATGGACCAGTACTGG - Intronic
937154098 2:119706312-119706334 CACAGCGCCTGGCCGAATTCTGG + Intergenic
937196467 2:120161671-120161693 AACAGGCCATGGACCAGTACCGG - Intronic
937886409 2:126902409-126902431 CCCATGGCATGGCCAAATACTGG - Intergenic
938904843 2:135827791-135827813 AACAGGCCATGGACCAGTACTGG + Intronic
939291638 2:140203612-140203634 AACAGGCCATGGACCAGTACAGG + Intergenic
940893255 2:159055755-159055777 CACAGTGCAGGGGCCAGTACAGG - Intronic
941447333 2:165618119-165618141 CACAGGCCCTAGCCAAGTACAGG - Intronic
943156645 2:184187770-184187792 AACAGGCCATGGACCAGTACTGG + Intergenic
946247685 2:218396817-218396839 CACAGAGCCTGGCAGAGGACTGG - Exonic
946655885 2:221946596-221946618 AACAGTCCATGGACGAGTACCGG + Intergenic
1171214459 20:23342136-23342158 CACACGGCCTGGCCGAACACTGG + Intergenic
1171226766 20:23448351-23448373 CCCAGGCCCTGGCTGAGTACAGG + Intergenic
1171365691 20:24622427-24622449 AACAGGCCATGGACCAGTACTGG - Intronic
1171375948 20:24694228-24694250 CCCAGGGAATGGCCGAGTTCTGG - Intergenic
1172027711 20:31960379-31960401 CCCAGGGCCTGGCCGAGTGCAGG - Intergenic
1172356098 20:34281069-34281091 CACAGGACATGCCCAGGTACTGG + Exonic
1173011938 20:39190828-39190850 CCCAGGGCATAGCTGAGGACAGG + Intergenic
1174714809 20:52746356-52746378 AACAGGCCATGGACCAGTACCGG - Intergenic
1175212419 20:57369239-57369261 CTCAGGGCATGGCCCAAAACAGG + Intronic
1176031516 20:63015264-63015286 CACGGAGCACGGCCGAGCACAGG - Intergenic
1177231492 21:18326543-18326565 CACAGGGCCTGGCCCAGTAAAGG - Exonic
1178352325 21:31881038-31881060 CAAGGGGCATGGCCTCGTACGGG + Intronic
1180550287 22:16532160-16532182 CACAGGGCATGGCCAAAAACAGG - Intergenic
1181354381 22:22289648-22289670 CACAGGGCATGGCCAAAAACAGG + Intergenic
1181807624 22:25384509-25384531 CACAGGGCATGGCCAAGGGAAGG + Intronic
1184129943 22:42511843-42511865 GACAGGGCAGGGCCGAGGCCAGG - Exonic
1184608578 22:45588258-45588280 CAGAGGGAATGGCAGAGTGCTGG + Intronic
1184850278 22:47115832-47115854 CACAGGACATGGCTCAGTTCTGG - Intronic
1185369274 22:50453361-50453383 CACAGGGTTTGGGGGAGTACGGG - Intronic
1185376339 22:50484209-50484231 CACAGGGCCTCGTGGAGTACAGG - Exonic
949924787 3:9032542-9032564 CACAGGGCCTGGCCAAGGACAGG + Intronic
950250216 3:11458782-11458804 CCCAGGCCATGGACCAGTACTGG + Intronic
952162972 3:30714258-30714280 AACAGGCCATGGACCAGTACAGG - Intergenic
952400039 3:32954843-32954865 CAGAGGGAATTGCAGAGTACTGG + Exonic
952883125 3:37997831-37997853 CACATGCCATGGAAGAGTACAGG - Intronic
952991239 3:38832845-38832867 CTCAGTGCCTGGCCGACTACAGG + Intergenic
953202088 3:40786842-40786864 AACAGGGCATGGACTGGTACTGG + Intergenic
953814977 3:46147732-46147754 AACAGGGCATGGACAAGTACTGG + Intergenic
954284614 3:49609992-49610014 CACAGGGCCTGGCCCAGAGCAGG - Intronic
954393010 3:50277168-50277190 CACATAGCAAGGCCGAGGACTGG - Intronic
954425647 3:50441623-50441645 CACTGGGCATGGCCCATTCCTGG + Intronic
954464729 3:50647743-50647765 CAAAGGGCTTGGCCCAGTGCTGG + Intronic
955733159 3:62008905-62008927 AACAGGCCATGGACTAGTACTGG + Intronic
956273789 3:67476185-67476207 AACAGGCCATGGACCAGTACTGG - Intronic
957856753 3:85889347-85889369 CACAGGGCATCCTCAAGTACAGG + Intronic
961580902 3:127881334-127881356 AACAGGCCATGGACTAGTACCGG + Intergenic
967805542 3:193711689-193711711 CACAGGTCATGGCCGGGCACTGG + Intergenic
968789505 4:2649792-2649814 AACAGGCCATGGACTAGTACTGG - Intronic
971015787 4:22487519-22487541 AACAGGCCATGGACTAGTACCGG + Intronic
971743870 4:30553569-30553591 AACAGGCCATGGATGAGTACTGG - Intergenic
972269892 4:37501220-37501242 CACAGGCCATGGATCAGTACTGG + Intronic
973018123 4:45166791-45166813 AACAGGTCATGGACTAGTACCGG + Intergenic
973729376 4:53808958-53808980 AACAGGGCATGGACTGGTACTGG - Intronic
973829863 4:54747785-54747807 AACAGGCCATGGACCAGTACCGG + Intergenic
976417931 4:84800929-84800951 AACAGGACATGGACCAGTACTGG + Intronic
977817507 4:101431891-101431913 AACAGGCCATGGACCAGTACCGG + Intronic
977876713 4:102158270-102158292 CACAGGCCATGGACAGGTACCGG + Intergenic
977920205 4:102634760-102634782 CACAGGTCATGGCGGAGGGCAGG - Intronic
978339474 4:107707154-107707176 TACAGGGAATGGCCTTGTACTGG + Intronic
983354131 4:166633342-166633364 CCCAGGCCATGGACCAGTACTGG - Intergenic
985270940 4:188194574-188194596 CACAGTGCACTGCAGAGTACTGG + Intergenic
986197968 5:5555272-5555294 TACAGGCCATGGCCCAGTACTGG - Intergenic
987051825 5:14153537-14153559 CACAGTGCCTGGCAAAGTACAGG - Intronic
989093107 5:37755125-37755147 CACAGGGAAAGGCCGAATCCTGG - Intergenic
989628803 5:43460275-43460297 CCCAGGCCATGGACCAGTACAGG - Intronic
990275658 5:54193381-54193403 AACAGGCCATGGACCAGTACCGG - Intronic
993913149 5:93708694-93708716 CAGAGGCCATGGACCAGTACTGG - Intronic
994479991 5:100322513-100322535 CGCAGGCCATGGACCAGTACTGG + Intergenic
996962207 5:129264585-129264607 CCCAGGCCATGGACCAGTACTGG + Intergenic
997446960 5:133947324-133947346 CACAGGGCCTGGCTCAGTACAGG + Intergenic
997653487 5:135538757-135538779 CACAGTGCCTGGCCCAGCACAGG - Intergenic
997840298 5:137233568-137233590 CCCAGGCCATGGACTAGTACTGG - Intronic
1001252376 5:170156444-170156466 CACAGTGCTTGCCCAAGTACTGG - Intergenic
1002643353 5:180640951-180640973 CACAGGGCATGGCTGGGTCCAGG + Intronic
1002954164 6:1845871-1845893 AACAGGCCATGGACCAGTACTGG + Intronic
1003984364 6:11420108-11420130 CACAGGGTCTGGCCTAGTGCTGG - Intergenic
1003994243 6:11522905-11522927 CATAGGGAATGGCTGAGCACAGG + Intergenic
1004897110 6:20159158-20159180 CCCAGGCCATGGGCCAGTACTGG + Intronic
1004897114 6:20159171-20159193 AACAGGCCATGGACCAGTACTGG - Intronic
1004897280 6:20161004-20161026 AACAGGCCATGGACCAGTACTGG - Intronic
1009052240 6:58290062-58290084 AACAGGCCATGGACCAGTACCGG + Intergenic
1009482169 6:64172661-64172683 AACAGGTCATGGACCAGTACTGG + Intronic
1010601178 6:77828263-77828285 AACAGGCCATGGACCAGTACTGG - Intronic
1010736859 6:79452939-79452961 CTGAGGGCATGGCTGAGTGCAGG - Intergenic
1013221971 6:108085767-108085789 CACTGCGCCTGGCCGAGCACAGG - Intronic
1013227106 6:108127763-108127785 CCCAGGCCATGGACAAGTACTGG - Intronic
1017693850 6:156994650-156994672 CACAGGGGATGGCCCAGATCAGG - Intronic
1017906249 6:158759124-158759146 CACAGGGCTTGGCATAGGACAGG + Intronic
1018664727 6:166125229-166125251 AACAGGCCATGGACCAGTACCGG + Intergenic
1019949680 7:4361367-4361389 CCCAGGTCATGGACCAGTACTGG - Intergenic
1021423530 7:20472405-20472427 CATAGGGCATGGCAGGGTAATGG + Intergenic
1031135806 7:117882795-117882817 AACAGGCCATGGACCAGTACTGG + Intergenic
1031387063 7:121164159-121164181 CCCAGGGCATGGCCCACTGCTGG + Intronic
1032766303 7:134997304-134997326 CACAGGCCATAGACCAGTACTGG + Intronic
1033916085 7:146328038-146328060 AACAGGCCATGGACCAGTACCGG - Intronic
1034729969 7:153378572-153378594 CCCAGGCCATGGACCAGTACTGG - Intergenic
1035901545 8:3462348-3462370 AGCAGGCCATGGACGAGTACTGG - Intronic
1036500304 8:9308095-9308117 GACAGGGCAGGGCAGGGTACAGG - Intergenic
1037954005 8:23039273-23039295 CCCAGGCCATGGACCAGTACTGG - Intronic
1041618425 8:59935473-59935495 CACCGTGCCTGGCCGAGTGCAGG - Intergenic
1042145871 8:65729997-65730019 AACAGGCCATGGACCAGTACCGG - Intronic
1044756893 8:95472903-95472925 CCCAGGGCATGGAAGAGTAATGG + Intergenic
1044860120 8:96514877-96514899 AACAGGCCATGGACCAGTACTGG + Intronic
1045098302 8:98821092-98821114 AACAGGCCATGGACCAGTACTGG - Intronic
1045641781 8:104259523-104259545 TCCAGGGCATGGACCAGTACCGG - Intergenic
1045984644 8:108235554-108235576 CCCAGGTCATGGACCAGTACCGG - Intronic
1047177847 8:122558309-122558331 AACAGGCCATGGACCAGTACTGG + Intergenic
1047254134 8:123203031-123203053 CACAGGGCATGACAGAGCAGTGG + Intronic
1047791153 8:128205230-128205252 AACAGGACATGGACCAGTACAGG - Intergenic
1048780720 8:137997088-137997110 AACAGGCCATGGACCAGTACTGG - Intergenic
1048992578 8:139770014-139770036 CACAGGGCCTGGCCCACCACTGG - Intronic
1049503548 8:142982209-142982231 CACAGGGCAGTGCCGAGCCCAGG - Intergenic
1050933729 9:11366554-11366576 CACAGGGCAGGTCTGAGCACGGG - Intergenic
1052699459 9:31920555-31920577 AACAGGCCATGGACCAGTACTGG - Intergenic
1055029417 9:71758468-71758490 CTCAGAGCATGGCCGAAAACAGG + Intronic
1055764268 9:79644706-79644728 CACAGGGAAGGGCCCAGGACTGG - Intronic
1059383104 9:113943785-113943807 CACAGGGCACAGCCGAGGCCAGG - Intronic
1060153752 9:121304808-121304830 CACAGGGCCTGGCAGAGTTAAGG - Intronic
1060876129 9:127084759-127084781 CAAAGGGCATGGCCCCGCACTGG - Intronic
1061145244 9:128793861-128793883 CTCAAGGAATGGCCGAGTGCCGG + Intronic
1061185040 9:129048180-129048202 CACAGGGCCAGGCCGAGGAGAGG - Intronic
1061389061 9:130307219-130307241 CAGAGGTCATGACCGAGTCCTGG - Intronic
1061419391 9:130464904-130464926 CCCAGGGCAGGGCCGAGCAGTGG + Intronic
1061505226 9:131028018-131028040 AACAGGCCATGGACCAGTACCGG - Intronic
1062048825 9:134436909-134436931 CACGGGGCTTGGGCGACTACAGG + Exonic
1062098649 9:134716395-134716417 CACGGGGCATCGCTGAGCACAGG - Intronic
1062255041 9:135616829-135616851 CACAGGGCATGGGGGGGTCCAGG + Intergenic
1062532419 9:137007761-137007783 CACAGGGCATGGCCGAGTACAGG + Exonic
1062636081 9:137492569-137492591 CACAGGGCAGGGCCGTGGGCTGG + Intronic
1185929430 X:4185887-4185909 CACAGGCCATGGACGAGTAGTGG + Intergenic
1186565166 X:10654679-10654701 CCCAGGCCATGGACTAGTACCGG - Intronic
1186577420 X:10781018-10781040 AACAGGCCATGGACCAGTACCGG + Intronic
1188995443 X:36879600-36879622 CACCGCGCATGGCCCAGGACAGG - Intergenic
1190626690 X:52344011-52344033 CACAGGGCAAGGCTGAGTACAGG + Intergenic
1190701320 X:52991818-52991840 CACAGGGCAAGGCTGAGTACAGG - Intronic
1192177438 X:68894743-68894765 CACAGGGCAGGGCTGAGCGCGGG + Intergenic
1194666061 X:96678778-96678800 CACCGCGCCCGGCCGAGTACAGG - Intergenic
1194916642 X:99716944-99716966 CACAGGGGCTGGCTGAGTGCTGG - Intergenic
1195124265 X:101790039-101790061 CCCAGGTCATGGACCAGTACTGG + Intergenic
1195892138 X:109707582-109707604 AACAGGCCATGGACCAGTACCGG + Intronic
1200184114 X:154170567-154170589 GACAGGGCATGGACAAGTCCTGG - Intergenic
1200189768 X:154207695-154207717 GACAGGGCATGGACAAGTCCTGG - Intergenic
1200195521 X:154245504-154245526 GACAGGGCATGGACAAGTCCTGG - Intergenic
1200201173 X:154282625-154282647 GACAGGGCATGGACAAGTCCTGG - Intronic
1201190946 Y:11441275-11441297 CACAGGGCATGGCCAAAAACAGG - Intergenic