ID: 1062533450

View in Genome Browser
Species Human (GRCh38)
Location 9:137011539-137011561
Sequence GGGCGTGATGGACCACCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062533447_1062533450 -10 Left 1062533447 9:137011526-137011548 CCGGGTACATGATGGGCGTGATG 0: 1
1: 0
2: 1
3: 11
4: 69
Right 1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1062533442_1062533450 8 Left 1062533442 9:137011508-137011530 CCTCGAACCAGAAGGAGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1062533444_1062533450 1 Left 1062533444 9:137011515-137011537 CCAGAAGGAGGCCGGGTACATGA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062533450 Original CRISPR GGGCGTGATGGACCACCTGC GGG Exonic
900122417 1:1054466-1054488 GGGCCTCATTGCCCACCTGCAGG - Exonic
900298258 1:1963765-1963787 GGGCGTGGAGGAGCACCTCCGGG - Exonic
900311613 1:2036037-2036059 AGGTGTGATGGACCGCGTGCAGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
910374333 1:86552639-86552661 GGGCGAGCTGGACCACATGGTGG - Intronic
917110386 1:171541535-171541557 GGGCGTGATGGACGGCCTCCAGG - Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920267029 1:204731635-204731657 GGGCGCAATGGCCCCCCTGCCGG + Intergenic
920499260 1:206476182-206476204 GGCCGGCATGAACCACCTGCGGG + Exonic
1063133422 10:3197143-3197165 GGGCCTGAGGACCCACCTGCAGG - Intergenic
1063567013 10:7180062-7180084 GGGCTTGTTGCCCCACCTGCTGG + Intronic
1064124846 10:12650884-12650906 GGGCGAGATGAACCCCCTGATGG - Intronic
1065274915 10:24076077-24076099 GGGCCTGATGAACAACCTGTGGG + Intronic
1067762900 10:49063058-49063080 AGGCATGAGGCACCACCTGCAGG - Intronic
1074015341 10:109528724-109528746 GGGCCTGCTGGGCCTCCTGCTGG - Intergenic
1084598604 11:70131859-70131881 GGCCATGATGGAGCACCTCCTGG - Intronic
1087757889 11:102073902-102073924 GTGCGTGGTAGACCTCCTGCTGG + Intronic
1094238067 12:28190803-28190825 GGGCGTGACCAACCTCCTGCGGG + Intronic
1095459865 12:42432057-42432079 GGTCGTGGTGGACCACGTGGTGG - Intronic
1101747938 12:107558369-107558391 GGGCATCCTGGAGCACCTGCAGG - Intronic
1101983471 12:109427512-109427534 GGGGCTGATGGAGCACCTGCGGG + Exonic
1102383442 12:112486549-112486571 GGGCGTGCTGGACTTCCTGGAGG + Exonic
1103828762 12:123762330-123762352 CGGCGCCATGGACGACCTGCGGG + Intergenic
1104376686 12:128269231-128269253 GGGCGTGACCGACCTCCTCCGGG + Intronic
1113576047 13:111396075-111396097 AGGGGTGATGGACCCCCTCCTGG + Intergenic
1121282984 14:92712817-92712839 GTCCATGATGAACCACCTGCCGG - Exonic
1122946184 14:105011224-105011246 GGGCGAGCTGGACCACGTGGTGG - Exonic
1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123644375 15:22428405-22428427 CGGCTTTATGGACCACCTGGAGG - Intergenic
1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG + Intergenic
1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG + Exonic
1124298260 15:28523344-28523366 CGGCTTTATGGACCACCTGGAGG - Exonic
1131440504 15:92456089-92456111 GGTCTTGCTGGACCTCCTGCTGG + Intronic
1132760790 16:1507673-1507695 GGACCTGATGGACGAGCTGCTGG + Exonic
1132903404 16:2270271-2270293 GGGCGTGACGCAGCACCAGCTGG + Intergenic
1136186891 16:28593553-28593575 GGGCAACATAGACCACCTGCAGG + Exonic
1136189475 16:28607062-28607084 GGGCAACATAGACCACCTGCAGG + Exonic
1136317555 16:29463338-29463360 GGGCAACATAGACCACCTGCAGG - Exonic
1136432130 16:30202683-30202705 GGGCAACATAGACCACCTGCAGG - Exonic
1137696827 16:50467230-50467252 GGGCGTGGTGGCACACCTGTAGG + Intergenic
1139777951 16:69329093-69329115 GCACGAGATGGACCACCTGCAGG - Exonic
1141374797 16:83520697-83520719 GGGCTTAATGGAACACTTGCAGG + Intronic
1141510284 16:84507349-84507371 GGGCTGCATGGACCACCTTCTGG + Intronic
1141884185 16:86880466-86880488 GGGTGTGCTGGGCCACGTGCAGG + Intergenic
1144784680 17:17824961-17824983 GGGGGTGAGGGAACACCCGCGGG - Intronic
1145207858 17:20994295-20994317 GGGCGTGGTGGATCAGCTGCTGG + Intergenic
1146650157 17:34601611-34601633 GGCCCTGATGGCCCAGCTGCTGG - Intronic
1147365020 17:39953501-39953523 GGGCGTGATCGGCCTCCTCCTGG + Intergenic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1154394213 18:13972041-13972063 TGGCCTGATGGACGAGCTGCGGG - Intergenic
1160491139 18:79337380-79337402 CGGCGTGGAGGACCAGCTGCAGG + Exonic
1160728485 19:629608-629630 GGCCGTGGTGGACGACCAGCAGG + Exonic
1163471673 19:17500815-17500837 GGGCGTGCTGAGCCGCCTGCTGG + Exonic
1165903229 19:39178441-39178463 GGGCTTCCTGGACCGCCTGCTGG + Exonic
1166803198 19:45470355-45470377 GGGTGTGATTCACCACCCGCTGG + Intronic
1167504441 19:49863694-49863716 GGGCATGTGGGACCATCTGCAGG - Exonic
926996421 2:18740748-18740770 GGGCCTGGTGGACTGCCTGCTGG - Intergenic
942485469 2:176435204-176435226 GGTAGTGATGGACCACCTACTGG - Intergenic
946253800 2:218429386-218429408 GGAGGTGATGAACCACGTGCTGG + Exonic
946400745 2:219467196-219467218 GGCCGTGCTGGCCCCCCTGCAGG + Exonic
1173385325 20:42582227-42582249 GGGTGTGAAGGAGCTCCTGCAGG + Intronic
1173897465 20:46561932-46561954 GGCAGGGATGGCCCACCTGCAGG - Intronic
1174588255 20:51625239-51625261 GGGCGTGGAGGACCAGCTGCAGG - Exonic
1175995797 20:62811857-62811879 AGGGGTGATGGAGAACCTGCAGG + Intronic
1176728518 21:10465698-10465720 GGGCGTGATGGCCCGTGTGCAGG + Intergenic
1181031163 22:20149434-20149456 GGGCGTGCTGGACCAGATGGAGG - Exonic
1181512173 22:23393962-23393984 GGGCGTGCTGGACCAGATGGAGG + Intergenic
1184390863 22:44202342-44202364 GGGCAGGCAGGACCACCTGCGGG + Intronic
1184493713 22:44825392-44825414 GGGCTGGATGCCCCACCTGCAGG - Intronic
1185011600 22:48317684-48317706 GGGCCTGATGGAGCACTTGGGGG - Intergenic
1185194233 22:49458806-49458828 GGGCGGGATGGACACCCCGCAGG - Intronic
952342277 3:32456479-32456501 GGGCATGATGAAACACCTGTAGG + Intronic
954205268 3:49054239-49054261 GGGCCTGATGGTCCAATTGCAGG - Intronic
954863774 3:53711956-53711978 GGGCTTGATGCAGCACCTGAAGG + Intronic
960640116 3:119815748-119815770 CCGCGTGGTGGACCAGCTGCAGG + Exonic
966530112 3:180968212-180968234 GGTCGTGGTGGACCACGTGGTGG + Exonic
971292797 4:25360010-25360032 GGACTTGATGGACCACTTGATGG + Intronic
975866012 4:78724242-78724264 GGGCATGATTGACCTGCTGCAGG - Intergenic
985978609 5:3443344-3443366 GGACGTGAAGGACCTCCTCCAGG + Intergenic
987070924 5:14336278-14336300 GGTAGTGATGGACTATCTGCAGG - Intronic
989051302 5:37322735-37322757 GGGCATGGTGGATCACCTGAAGG + Intronic
998172466 5:139880757-139880779 GTGCGAGATGGATCACATGCAGG + Intronic
1006374211 6:33662904-33662926 GGTCGTGGTGGACCACCTAGGGG - Exonic
1007570978 6:42890695-42890717 GGCCCTGCTGGACCAGCTGCAGG + Exonic
1010752601 6:79631627-79631649 GAGTGTGATGGATCACCTGCCGG - Intronic
1011405927 6:87015526-87015548 GGCCGTGACGGACCTCCTGGTGG + Exonic
1018335134 6:162778760-162778782 GGGCGTGCTGCTCCACCTGCCGG - Intronic
1022837851 7:34134064-34134086 GGGCGAGATGGGCCACCACCAGG - Intronic
1023965931 7:44963070-44963092 GGGCGTGCAGCACCACCAGCTGG + Exonic
1024359756 7:48455580-48455602 GGGCGTGCTGGGCCCTCTGCAGG - Intronic
1026582803 7:71632268-71632290 GGCCCTGGGGGACCACCTGCCGG + Intronic
1029356148 7:100053347-100053369 GGGAGTCATGCAGCACCTGCTGG - Intronic
1032020573 7:128405426-128405448 GGGCGTCCTGGACCAGCGGCTGG + Intronic
1033822172 7:145147945-145147967 GGGCACCATGGACCACATGCTGG + Intergenic
1034898082 7:154890337-154890359 GGGAGGGAGGGACCACCTGTGGG + Intronic
1036286056 8:7445043-7445065 GGGTGTGTTAGATCACCTGCAGG - Intronic
1036335417 8:7866486-7866508 GGGTGTGTTAGATCACCTGCAGG + Intronic
1037833395 8:22201955-22201977 GGGCTTGAAGGACCTGCTGCTGG + Intronic
1037939171 8:22938611-22938633 AGGGGTAATGGAGCACCTGCTGG - Intronic
1043305065 8:78783362-78783384 TGGAGTAATGGCCCACCTGCAGG - Intronic
1045112681 8:98949045-98949067 GGCCACGGTGGACCACCTGCAGG + Exonic
1049748787 8:144273972-144273994 GGGCTTCAGGGACCCCCTGCTGG - Intronic
1057444952 9:95107236-95107258 GGCCGTGCTGGGCCACCTCCTGG - Exonic
1060665270 9:125428826-125428848 GGGCCTGAAGGGCCACCTCCAGG - Intergenic
1060776825 9:126380677-126380699 GGGTGTGATGAGCCACCTGAGGG - Intronic
1060847906 9:126851727-126851749 GGGCGTGATAGAGAAGCTGCAGG + Intergenic
1062337659 9:136079486-136079508 GGGCTTGCTGCCCCACCTGCTGG - Intronic
1062448226 9:136604633-136604655 TGCCGTGATAGCCCACCTGCTGG + Intergenic
1062482014 9:136756912-136756934 GGGAGTGCTGGCCCACCAGCGGG + Intronic
1062525790 9:136977620-136977642 GGGGGTGCTGGGCGACCTGCAGG + Exonic
1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG + Exonic
1062606520 9:137351049-137351071 GGGCGGCATGGACCTGCTGCTGG - Exonic
1197947204 X:131852140-131852162 TGGTGTGATGGACCCCGTGCGGG + Intergenic
1199602738 X:149552272-149552294 GGGTGGGATGAACCAACTGCAGG - Intergenic
1199647651 X:149927203-149927225 GGGTGGGATGAACCAACTGCAGG + Intergenic