ID: 1062535012

View in Genome Browser
Species Human (GRCh38)
Location 9:137017597-137017619
Sequence GGTGAGTGCTGTCACGGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062535004_1062535012 20 Left 1062535004 9:137017554-137017576 CCACGTGGCTGTGCATAAGCACC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1062535012 9:137017597-137017619 GGTGAGTGCTGTCACGGAGATGG 0: 1
1: 0
2: 1
3: 6
4: 143
1062535010_1062535012 -6 Left 1062535010 9:137017580-137017602 CCGTACTTCAGGATGGCGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1062535012 9:137017597-137017619 GGTGAGTGCTGTCACGGAGATGG 0: 1
1: 0
2: 1
3: 6
4: 143
1062535008_1062535012 -1 Left 1062535008 9:137017575-137017597 CCTGGCCGTACTTCAGGATGGCG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1062535012 9:137017597-137017619 GGTGAGTGCTGTCACGGAGATGG 0: 1
1: 0
2: 1
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062535012 Original CRISPR GGTGAGTGCTGTCACGGAGA TGG Exonic
900959561 1:5910301-5910323 GGAGAGTCCTGTCACCGTGAAGG - Intronic
903378608 1:22881965-22881987 TGTGAGTGCTCTCACAGAGGTGG - Intronic
903619584 1:24688214-24688236 GGTGACTGGTGACACAGAGAGGG + Intergenic
908667642 1:66510416-66510438 GGTGGGTGCTGTCAGGGGCAGGG - Intergenic
908971060 1:69832276-69832298 GTTGAGTACTGTCTCTGAGAGGG + Intronic
909594203 1:77386832-77386854 GGTGAGCGCAGGCAGGGAGAGGG - Intronic
910271931 1:85405412-85405434 TGTGAGTACAGACACGGAGATGG + Intronic
911753057 1:101520866-101520888 GGGGAGCGGTGTCACGGATATGG + Intergenic
912696803 1:111848190-111848212 AGGGAGTGCAGTCACGGGGAAGG + Intronic
912722343 1:112030754-112030776 GCTGGGGGCTGTCAGGGAGATGG - Intergenic
915330989 1:155112261-155112283 GGTGAGGGCAGTCAAGGATAAGG - Intergenic
917737832 1:177936730-177936752 GCTGAGTGATGCCAGGGAGATGG - Intronic
922196736 1:223365068-223365090 GGTGATTGGTGACACGCAGAAGG + Intergenic
1063722159 10:8595010-8595032 TATGAGTGCTGTCCTGGAGAGGG + Intergenic
1064308233 10:14187727-14187749 GCAGAATGCTGTCACAGAGAAGG + Intronic
1065497378 10:26343086-26343108 GATGAATGCTATCACCGAGATGG + Intergenic
1065850506 10:29783790-29783812 GGTGAGGGCTGCCAGGGGGAAGG + Intergenic
1067475459 10:46562250-46562272 GGTGAGTGCTCTCTTGCAGAAGG + Intergenic
1067619277 10:47779513-47779535 GGTGAGTGCTCTCTTGCAGAAGG - Intergenic
1068661995 10:59632198-59632220 GGATAGTGCTGTCATGGAGGTGG - Intergenic
1071490369 10:86132089-86132111 TGACAGTGCTGTCATGGAGAGGG + Intronic
1071967094 10:90862581-90862603 GAGGGGTGCTGTCACTGAGAAGG - Intergenic
1075451761 10:122556753-122556775 CGTGAGTGCTGTCCTGGACATGG + Intergenic
1076303665 10:129447695-129447717 GGGGAGTGGAGTCACAGAGAAGG + Intergenic
1082802267 11:57423960-57423982 GGTGAGTGCTGTCAGGTGGGTGG - Exonic
1085056242 11:73405753-73405775 GGTGAGTCCTGGCACTGGGAAGG + Intronic
1094063514 12:26340145-26340167 GGTGGGTGCATTCAGGGAGATGG - Exonic
1101325139 12:103709179-103709201 GGTGAGGGCGGTCAAAGAGAAGG + Intronic
1102569704 12:113820013-113820035 ACTGAGTGCTGTGACTGAGAGGG + Intronic
1105566954 13:21558812-21558834 GGTGAGGGATGGCAGGGAGAAGG + Intronic
1107090935 13:36478833-36478855 GGGGAGTGGTGTCACAGATATGG - Intergenic
1118071692 14:62252586-62252608 GATGACTGCTGTAAGGGAGAGGG - Intergenic
1119619089 14:76118250-76118272 TCTGAGTGCTGTCCCGGAGAGGG + Intergenic
1120959509 14:90111688-90111710 GGGCAGTGTTGTCACAGAGAGGG - Intronic
1125251066 15:37705038-37705060 GGTGGCTGCTGTCAGGGAGAGGG + Intergenic
1128184611 15:65634021-65634043 GGTGTGGGCTGTGAGGGAGAGGG + Intronic
1128243463 15:66117259-66117281 GGAGAGTTCTGGCAGGGAGATGG - Intronic
1129513771 15:76144064-76144086 TCTGAGTGCTGTCACTGAAAAGG - Intronic
1131636060 15:94234432-94234454 GCTGAGTGTTCTCAGGGAGAGGG - Intronic
1136398490 16:30005483-30005505 CGTGTGTGCTGGCACGGGGAGGG - Exonic
1137916691 16:52439352-52439374 GGGGAGTGCTGCCGAGGAGAAGG + Exonic
1140035863 16:71370825-71370847 GGTCAGTGCTGTGATGGGGAAGG - Intronic
1140509820 16:75498926-75498948 GGGGAGGGCTGTCAAGGAGGAGG + Intergenic
1140515616 16:75539134-75539156 GGGGAGGGCTGTCAAGGAGGAGG + Exonic
1141696919 16:85624522-85624544 GGTGAGAGCTGCCACAGGGAGGG + Intronic
1141805336 16:86337977-86337999 GGTGAGTGGTGTCCAGGTGAGGG - Intergenic
1142685622 17:1575484-1575506 CGTGAACGCTGGCACGGAGACGG + Exonic
1145784073 17:27582805-27582827 GGGCAGAGCTGACACGGAGATGG - Exonic
1146630154 17:34463813-34463835 GGCTAGTGCTGTGACGGAGGTGG - Intergenic
1147895658 17:43749785-43749807 AGGGAGTGCTGGCAAGGAGATGG - Intergenic
1148687719 17:49509848-49509870 GGGGAGTGCTCTCAGGGAGGTGG + Intronic
1153527684 18:6013291-6013313 AGAGAGAGCTGGCACGGAGAAGG - Intronic
1160076780 18:75684909-75684931 GCTAAGTGCTGTAACGGGGAGGG + Intergenic
1160854465 19:1210202-1210224 GCAGAGTGCTGTCAAGGAGAAGG + Intronic
1161030278 19:2054905-2054927 GCTGAGTGCTGGCAGGGAGTGGG - Intergenic
1163251424 19:16128414-16128436 GGTGAGTGGTGTGGCTGAGAGGG - Intronic
1163397112 19:17070105-17070127 GGTGTTTGCTGTCAAGGGGATGG - Intronic
1165220286 19:34310728-34310750 GATGAGTGCTGTGATGCAGATGG + Intronic
1168291249 19:55358777-55358799 GGTGAGCGCTTCCACAGAGAAGG + Exonic
925207167 2:2016563-2016585 ACTGAGTGCTGTGACAGAGAAGG - Intronic
926712111 2:15890043-15890065 GATGAGTGCTGTCACGTGGCAGG - Intergenic
926739776 2:16101725-16101747 GGTCAGTGGTGTCACAGAGCTGG + Intergenic
929605562 2:43231974-43231996 GGTGGGTGCAGTCACAGATAGGG - Intronic
930055617 2:47249941-47249963 TGTGAATGCTTTCACTGAGAAGG - Intergenic
932493372 2:72134924-72134946 GGTGAGGGCTGTCACTCATATGG + Intronic
938118315 2:128617132-128617154 GGTGAGTGCTCTCCCTGAGCAGG - Intergenic
940324321 2:152409509-152409531 TGTGAGTGAGGTCATGGAGAAGG + Intronic
941907138 2:170727762-170727784 GGTTCTTGCTGTCACGGAGCTGG + Intergenic
943484206 2:188458811-188458833 GTGGAGTGCTGTGAGGGAGATGG - Intronic
946368339 2:219264954-219264976 GGTGAGTGCAGACACAGAGCTGG + Intronic
946658345 2:221973307-221973329 GGTGAGTGCCTTCAACGAGATGG - Intergenic
1170523698 20:17215399-17215421 TCTGAGTGCTGCCATGGAGAAGG + Intergenic
1172038291 20:32025855-32025877 GGTGAGAGCTGCCACACAGATGG + Intronic
1174289834 20:49500224-49500246 GATGGATGCTGACACGGAGATGG - Intergenic
1174929365 20:54795370-54795392 GTGCACTGCTGTCACGGAGAGGG - Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1176667382 21:9700020-9700042 GGAGGGTGGGGTCACGGAGATGG - Intergenic
1177727030 21:24983156-24983178 GGTGAAGTCTGTCCCGGAGATGG + Intergenic
1179548486 21:42127495-42127517 GGCGAGTGCTGTCATGGACCTGG + Intronic
1180864269 22:19106891-19106913 GCTGACTGCTGTCTCGGTGAAGG - Intronic
1181934080 22:26427532-26427554 GGTGAGTTCTGGAACAGAGAGGG + Intergenic
1181934123 22:26427670-26427692 GGTGAGTTCTGGAACAGAGAGGG + Intergenic
1183324599 22:37184507-37184529 GGTGAGGGCTGTCCAGGTGAGGG - Intronic
1183324603 22:37184522-37184544 GGTGAGGGCTGTCCAGGTGAGGG - Intronic
1184293484 22:43510001-43510023 GTTGGGTGCTGTCACGGAGAAGG + Intergenic
952563559 3:34626704-34626726 GGTGAGTGGTGACACCCAGAAGG - Intergenic
952993744 3:38856312-38856334 GGTGAGTGCGGCCCCAGAGAAGG + Intronic
954431715 3:50474171-50474193 GGTGACTGCTGGGAGGGAGAGGG + Intronic
957037716 3:75310506-75310528 CCTGAGTGTTGTCAGGGAGAGGG + Intergenic
961085751 3:124066059-124066081 CCTGAGTGTTGTCAGGGAGAGGG + Intergenic
961207158 3:125093629-125093651 GGTAAGTGCTGTGAAGGAAATGG - Intronic
967875104 3:194263300-194263322 GGTGAGTGCAGTCTCATAGAAGG - Intergenic
970500120 4:16668397-16668419 ACTGAGAGCTATCACGGAGAGGG - Intronic
970559532 4:17269133-17269155 TGAGACTGCTGTCATGGAGAAGG + Intergenic
973607108 4:52599115-52599137 GGTGAGAAGTGTCATGGAGAAGG + Intronic
975840137 4:78465167-78465189 AATGAGTGCTGGCACAGAGAAGG - Intronic
981912314 4:149995642-149995664 GGTGAGTGGTGTCATGGGGGTGG + Intergenic
982037616 4:151361932-151361954 AGTGAGGACTGTCACGGAGTAGG + Intergenic
982835399 4:160115545-160115567 GGTGAGGGCTGTCATGGTGGGGG + Intergenic
983502587 4:168516327-168516349 GGTGAGTGATGTCAGGGAACAGG - Intronic
985407425 4:189651574-189651596 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407449 4:189651662-189651684 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407533 4:189651970-189651992 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407581 4:189652146-189652168 GGAGGGTGGGGTCACGGAGATGG + Intergenic
987568467 5:19624611-19624633 GATGAGTGCTGTCCTGGAAATGG + Intronic
997539440 5:134649173-134649195 GGTGAGTGCTGTCCGGGGGGAGG + Exonic
1001970870 5:175953990-175954012 GGTGAGTGTTGTCACAGAAATGG - Intronic
1002246568 5:177889774-177889796 GGTGAGTGTTGTCACAGAAATGG + Intergenic
1002818509 6:700435-700457 GGTGAGTGCTGTTACTGAATGGG - Intergenic
1006928541 6:37673296-37673318 GGCGAGAGGTGTCACGGCGAGGG - Intronic
1011152296 6:84287834-84287856 GGGAAGTGCTGTGATGGAGATGG - Intergenic
1012790564 6:103688849-103688871 GGTGTTTCTTGTCACGGAGAAGG - Intergenic
1015310285 6:131759659-131759681 GGTGAAGGCTGTCACACAGAGGG + Intergenic
1015917999 6:138237758-138237780 GGTGACTGCACTCACCGAGATGG - Intronic
1017911424 6:158796173-158796195 GTAGAGTGTTTTCACGGAGAAGG + Intronic
1019070604 6:169341851-169341873 GGTGAGTGTGGCCAGGGAGAGGG - Intergenic
1019715963 7:2539522-2539544 GGTGAGTGCTGGCAGGTGGAGGG - Exonic
1021804540 7:24342168-24342190 GGTTATTGTTGTCATGGAGAGGG - Intergenic
1027473069 7:78596456-78596478 GGTGAGTGCTTTCAAGGATGTGG + Intronic
1032750909 7:134840426-134840448 GGAGAGTTCAGCCACGGAGAAGG - Intronic
1035265836 7:157690014-157690036 GGGGGGTGCAGGCACGGAGATGG - Intronic
1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG + Intronic
1036124922 8:6053711-6053733 GGTCAGTACTTTCGCGGAGACGG - Intergenic
1036190102 8:6662384-6662406 GGTGAGTGGAGGCAGGGAGAGGG - Intergenic
1037677442 8:21063971-21063993 GGTTAGGGCTGTGACTGAGAAGG + Intergenic
1041260919 8:56019886-56019908 GGCGAGTGCTGTCTTGGAGATGG - Intergenic
1049756157 8:144312127-144312149 CGTGAGGGCTGTGACGGAGGCGG - Exonic
1050048845 9:1576621-1576643 GGAGAGTGATGTCACCAAGATGG - Intergenic
1051398898 9:16658312-16658334 GGGGAGTACTGTAAGGGAGAGGG + Intronic
1053323050 9:37117619-37117641 GGTAAGTGCTGGGAAGGAGAAGG - Intergenic
1055961056 9:81820853-81820875 GGAGAGTGCAGTGACAGAGATGG + Intergenic
1057304400 9:93903962-93903984 GGTGAGGCCTTTCAGGGAGAGGG - Intergenic
1060263790 9:122097657-122097679 GGTGAGTGCTGGGAAGGAAAAGG - Intergenic
1062286040 9:135772949-135772971 AGTGAGTGCTGCCTTGGAGACGG + Exonic
1062535012 9:137017597-137017619 GGTGAGTGCTGTCACGGAGATGG + Exonic
1203658433 Un_KI270753v1:20678-20700 GGAGGGTGGGGTCACGGAGATGG + Intergenic
1187969015 X:24640879-24640901 AGTGAGTGCCATCACTGAGATGG - Intronic
1189229406 X:39440546-39440568 GGTGACTGCAGTCTCGGTGAAGG + Intergenic
1189621920 X:42850143-42850165 GGTGAGTGCTGAAACAGGGATGG + Intergenic
1190344208 X:49322386-49322408 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190345302 X:49331931-49331953 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190346397 X:49341497-49341519 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190347648 X:49532526-49532548 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190348749 X:49542082-49542104 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190349849 X:49551638-49551660 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190350954 X:49561191-49561213 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190352055 X:49570749-49570771 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190353156 X:49580298-49580320 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190354257 X:49589845-49589867 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1190355359 X:49599369-49599391 GGTGAGTGCTGTTGGGGGGATGG + Intronic
1192434968 X:71137407-71137429 AGGGAGGGCTGTCAGGGAGAGGG + Intronic