ID: 1062535411

View in Genome Browser
Species Human (GRCh38)
Location 9:137019061-137019083
Sequence CTGCTACATACTTGGGGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062535405_1062535411 -2 Left 1062535405 9:137019040-137019062 CCTCGGGGTGCAGCCGCAGCTCT 0: 1
1: 0
2: 3
3: 14
4: 252
Right 1062535411 9:137019061-137019083 CTGCTACATACTTGGGGTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 170
1062535401_1062535411 16 Left 1062535401 9:137019022-137019044 CCAGTGACAGGTTCAGTGCCTCG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1062535411 9:137019061-137019083 CTGCTACATACTTGGGGTGGAGG 0: 1
1: 0
2: 2
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062535411 Original CRISPR CTGCTACATACTTGGGGTGG AGG Exonic
901908433 1:12434595-12434617 TTGCTGCTTACTGGGGGTGGGGG - Intronic
903059930 1:20662429-20662451 TTGCTCCATTCTTGGGTTGGTGG - Intergenic
904480489 1:30790180-30790202 CTGCTACATGCTTGGGGATCAGG - Intergenic
904609413 1:31716803-31716825 CAGGCACATACTGGGGGTGGTGG - Intergenic
908445383 1:64195084-64195106 CTGCTACATATTCCTGGTGGAGG + Intergenic
914330221 1:146662201-146662223 CTGGAACCTACTTGAGGTGGAGG - Intergenic
914641181 1:149607744-149607766 CTGCCCCATACTTGGGGGTGGGG - Intergenic
915446158 1:155976144-155976166 CTGCTACCTCCTTGGGGGGATGG - Intronic
915942946 1:160130337-160130359 CTGCGGCATCCCTGGGGTGGGGG + Intronic
916936990 1:169639489-169639511 CTGCTAGATACTTCAGGTGATGG - Intergenic
919982904 1:202653475-202653497 GTGCTAGATGCTTTGGGTGGGGG - Intronic
922292625 1:224221142-224221164 CTGCTACTTAGGGGGGGTGGTGG - Intergenic
924863395 1:247950942-247950964 ATGATACATATTTGGGGTGCTGG + Intronic
1065237117 10:23664181-23664203 CTCCCAGATACATGGGGTGGGGG + Intergenic
1066491042 10:35895114-35895136 CTTCTACGTACTTGTGGTGGTGG + Intergenic
1067775745 10:49163658-49163680 CTGACACAAACTTGGGGTGGGGG + Intronic
1069208491 10:65724172-65724194 TTGGTACAAACTTTGGGTGGTGG + Intergenic
1069584082 10:69585575-69585597 CTACTACATACCTGGGGTTGGGG + Intergenic
1069647678 10:70015638-70015660 CTTCTATATTCTTGGGTTGGAGG + Intergenic
1072313158 10:94176648-94176670 GTGCTAGTCACTTGGGGTGGGGG + Intronic
1072782934 10:98262381-98262403 CTGCTACCTCCTTTGGGTGCTGG + Intronic
1074288714 10:112122149-112122171 CTGCTACATCTTGGGGATGGAGG + Intergenic
1074904244 10:117847050-117847072 TTGCCACAAACTTGGTGTGGAGG + Intergenic
1082820130 11:57539017-57539039 ACGCTGCATACTTAGGGTGGTGG - Intergenic
1084647507 11:70466961-70466983 ATGCTTCATACTTGGAGCGGAGG + Intergenic
1085723291 11:78932263-78932285 CTCCTACAACCTGGGGGTGGTGG - Intronic
1086236936 11:84643169-84643191 GTGCTAGTTACTTGGGTTGGGGG + Intronic
1087678134 11:101186141-101186163 ATGATACATACTTGAGGTGATGG + Intergenic
1088509780 11:110562417-110562439 CCCCTACATCCCTGGGGTGGGGG + Intergenic
1088942816 11:114478072-114478094 CTCTTTCGTACTTGGGGTGGGGG - Intergenic
1088993801 11:114978372-114978394 CTTCTACATTCTTGGGGTGGTGG - Intergenic
1092493478 12:8968540-8968562 CTGTTAATTACGTGGGGTGGGGG - Intronic
1095790461 12:46161667-46161689 GAGCTCCATTCTTGGGGTGGAGG - Intergenic
1100871531 12:98915069-98915091 CTGGGACTTACTGGGGGTGGTGG - Intronic
1101557181 12:105821364-105821386 CTGCCAGGTACTTGGGGTGAAGG + Intergenic
1101598814 12:106190496-106190518 TTGCTACATAATTGGGCTGGAGG + Intergenic
1103187613 12:118974085-118974107 CTAAAACATGCTTGGGGTGGGGG + Intergenic
1103417973 12:120757270-120757292 CTGCCACCTACTAGGGTTGGTGG + Intergenic
1104088018 12:125493561-125493583 CTGCTGTGTGCTTGGGGTGGGGG + Intronic
1111462326 13:88561588-88561610 CTACTACATATTGGAGGTGGGGG + Intergenic
1113028630 13:105969687-105969709 TTGTTACATACTTTGCGTGGGGG - Intergenic
1117600946 14:57373811-57373833 ATGCTACATGCTGGGAGTGGGGG - Intergenic
1118313396 14:64708819-64708841 CAGCGACATACTTGGGGGGTGGG - Intronic
1118746978 14:68781402-68781424 CTGCTGCCTGGTTGGGGTGGAGG - Intergenic
1120753333 14:88218528-88218550 CTGCCATATCCTTGGGGCGGGGG + Intronic
1121126910 14:91413870-91413892 GTCCTACAAACTTGGGGTGAAGG + Intronic
1121714755 14:96065653-96065675 CTACTACATGCTGGGGGTGGAGG - Intronic
1121788308 14:96679755-96679777 CTCAGACAGACTTGGGGTGGAGG + Intergenic
1127018165 15:54712174-54712196 CTCCAACATACTTTGTGTGGGGG - Intergenic
1127326053 15:57896287-57896309 CAGTTAAATACTTGGGATGGAGG - Intergenic
1127626465 15:60784995-60785017 CTTCCACATCCTTGGGTTGGGGG - Intronic
1128002565 15:64207020-64207042 CTGCTACATAATGGTAGTGGAGG + Intronic
1128629120 15:69245468-69245490 CTGCTAAATGCTCAGGGTGGTGG + Intronic
1128683496 15:69667698-69667720 CTGCCACATGGTGGGGGTGGGGG + Intergenic
1130179060 15:81606828-81606850 CTTCTACAAAATGGGGGTGGAGG + Intergenic
1134277106 16:12786347-12786369 CTGCAACTTACATGGGTTGGAGG + Intronic
1136518005 16:30779389-30779411 CTGCTACCATCTTGGGGAGGGGG + Exonic
1139348354 16:66319550-66319572 CTACTGCACACTTGGAGTGGAGG - Intergenic
1139568946 16:67798420-67798442 CTGCCACATTCCTGGTGTGGAGG - Intronic
1140003331 16:71048705-71048727 CTGGAACCTACTTGAGGTGGAGG + Intronic
1140462677 16:75153389-75153411 GTGGTACCTGCTTGGGGTGGAGG - Intronic
1141301154 16:82816790-82816812 CTGCTAGAAACTTCGGGGGGCGG + Intronic
1141797486 16:86285118-86285140 CTGCTGCATTATGGGGGTGGGGG + Intergenic
1142235836 16:88922130-88922152 CTGCGCCACACTTTGGGTGGGGG + Intronic
1143584082 17:7842820-7842842 CTGATTCAGGCTTGGGGTGGGGG - Intronic
1143712367 17:8743722-8743744 CTGAAACATCTTTGGGGTGGGGG + Exonic
1145117418 17:20224623-20224645 CTGCCACAGGCTTGGGGTGGCGG - Intronic
1145314975 17:21724844-21724866 CTTCTACACACCTGGGGTGTGGG - Intergenic
1145799932 17:27676453-27676475 CTGCTGCTTCCTGGGGGTGGTGG + Intergenic
1148285779 17:46390264-46390286 CTCCAAAATAGTTGGGGTGGGGG + Intergenic
1148307942 17:46607885-46607907 CTCCAAAATAGTTGGGGTGGGGG + Intronic
1148786500 17:50148582-50148604 CTTCTGCAAAGTTGGGGTGGGGG + Intronic
1149023558 17:51998205-51998227 CTGCTACATACTGGGGATCAAGG + Intronic
1151529355 17:74694867-74694889 CTCCTACATAGTTGAGGAGGGGG - Exonic
1151730229 17:75906636-75906658 CTGCTACATGCTAAGTGTGGAGG + Intronic
1152088045 17:78232113-78232135 CTGGTACATCCTGGAGGTGGCGG + Exonic
1153904587 18:9649940-9649962 CTGACACAAACTGGGGGTGGGGG + Intergenic
1157061426 18:44295580-44295602 TTGCTACATATTTGGGGTATTGG - Intergenic
1158453230 18:57585639-57585661 CTGACACCTACTTGGAGTGGAGG - Intronic
1162842122 19:13364210-13364232 CTGGTACATCCTGGGGGTTGGGG + Intronic
1163118887 19:15204006-15204028 GTTCCACCTACTTGGGGTGGCGG - Intergenic
1163183447 19:15619787-15619809 CAGCTGCAGCCTTGGGGTGGAGG + Intronic
1163189268 19:15664408-15664430 TAGCTGCAGACTTGGGGTGGAGG + Intergenic
1163810323 19:19427427-19427449 GTGCTAAGTACTGGGGGTGGGGG + Intronic
1163884192 19:19951375-19951397 CTCCTAAGTACTTGGTGTGGGGG - Intergenic
1165233679 19:34403859-34403881 CTACTACATAATTAAGGTGGTGG - Intronic
1166865303 19:45832427-45832449 CTGCTACAGGCTGGGTGTGGTGG - Intronic
1167478179 19:49712907-49712929 CTCCTGCATAGTGGGGGTGGAGG + Intronic
1167571263 19:50290449-50290471 AGGCAACAGACTTGGGGTGGAGG + Intronic
925395341 2:3529527-3529549 CAACTACATACATGTGGTGGTGG - Intergenic
926691188 2:15735026-15735048 CTGCTCACTACTTGGAGTGGTGG - Intronic
933126123 2:78608411-78608433 CTGCTACATAGCTAAGGTGGAGG - Intergenic
935532211 2:104248069-104248091 CTGCTTCCTACATGGAGTGGAGG + Intergenic
936892038 2:117382687-117382709 ATGATAAATACTTGGGGTGATGG - Intergenic
938307644 2:130266069-130266091 ATGCACCATACTGGGGGTGGAGG - Intergenic
938447690 2:131390773-131390795 ATGCACCATACTGGGGGTGGAGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941408727 2:165125720-165125742 CTGCTGGATACTAGGGGTGAAGG - Intronic
942934612 2:181540392-181540414 CTTGAACATAGTTGGGGTGGTGG - Intronic
944784384 2:203053631-203053653 GTCCCACTTACTTGGGGTGGGGG - Intronic
1168749396 20:271355-271377 CTGGTACGTACTTGGGTTGGGGG + Intronic
1172293424 20:33791706-33791728 CTGCAACATTCTAGGGTTGGGGG + Exonic
1172639981 20:36435064-36435086 ATGCTGCATACTTGTGGGGGGGG + Intronic
1172804525 20:37602000-37602022 CAGATACACTCTTGGGGTGGGGG + Intergenic
1174549131 20:51348918-51348940 CTGCTGCCTTCATGGGGTGGTGG + Intergenic
1178792374 21:35712320-35712342 CTGCTGCAAACTTGGGGAGACGG - Intronic
1178823786 21:35998435-35998457 CTGATACTTGCTTGGGGCGGTGG - Intronic
1180262211 21:46679723-46679745 GTGCTACGGACTTGGTGTGGAGG + Intergenic
1183093904 22:35541067-35541089 CTCCTAGAGACTTGGGGAGGGGG - Exonic
1184043631 22:41958680-41958702 CTGCCACAGTCTTGGGGAGGGGG - Intergenic
1185109367 22:48892514-48892536 GAGCTACATGCTGGGGGTGGAGG + Intergenic
952048113 3:29348863-29348885 CTACTGCAGACTTGGGCTGGAGG - Intronic
956626519 3:71272437-71272459 TTGCAATATACTAGGGGTGGGGG + Intronic
957384891 3:79483555-79483577 CTACTACATACTTGGGCTATAGG + Intronic
960941966 3:122940803-122940825 CTGCTAAGGACTTGGGGAGGGGG - Intronic
962150416 3:132886835-132886857 ATGATACATTCTTGAGGTGGTGG + Intergenic
962181918 3:133214934-133214956 TTTCTACAGACCTGGGGTGGGGG - Intronic
962734718 3:138315742-138315764 CTGCTACAGGCCTGGGGTTGAGG - Intronic
965325832 3:167302492-167302514 CTGCTTAAAACATGGGGTGGGGG - Intronic
965597266 3:170421196-170421218 CTCCCTCATACTTTGGGTGGAGG + Intronic
969041321 4:4298257-4298279 CTGCCACATACTTGGAGTAATGG + Intronic
969057434 4:4410472-4410494 CTGCTACACACCCGGGCTGGAGG + Intronic
969401438 4:6958269-6958291 CTGCTTCATACTGGGGGTCGAGG + Intronic
971349514 4:25843659-25843681 CTGCTGCATTCTGGGTGTGGGGG - Intronic
972286970 4:37658410-37658432 ATGCTCCATAGTTGTGGTGGTGG - Intronic
975318961 4:72988414-72988436 ATGATTAATACTTGGGGTGGAGG - Intergenic
975358005 4:73430844-73430866 TTGATACAAACTTGTGGTGGGGG + Intergenic
977892016 4:102323083-102323105 TCGCCACTTACTTGGGGTGGGGG - Intronic
978071483 4:104477520-104477542 CTGCTAAAAACTTGTGGGGGAGG - Intronic
978610827 4:110537122-110537144 CTGCTAGCTAATTAGGGTGGTGG + Intronic
981115698 4:140988641-140988663 TGGGTATATACTTGGGGTGGGGG - Intronic
981229372 4:142335300-142335322 CTAATATTTACTTGGGGTGGAGG + Intronic
981509252 4:145537579-145537601 CTGCTAAATACTTGGGTTGGGGG - Intronic
985651987 5:1111692-1111714 CTGCCACTAACGTGGGGTGGGGG + Intronic
989743183 5:44795809-44795831 CTGCTCTCTACTTGGGGGGGTGG - Intergenic
989997462 5:50852933-50852955 ACACTACTTACTTGGGGTGGTGG - Intergenic
991413010 5:66363580-66363602 CTGCTAACTGATTGGGGTGGTGG + Intergenic
997655378 5:135550489-135550511 CTGAGGTATACTTGGGGTGGGGG + Intergenic
998331681 5:141332854-141332876 CTGCTACAGGCTTCGGGAGGCGG + Exonic
998974491 5:147629332-147629354 CTGCTAAATACTAGGGTTGTTGG - Intronic
999226203 5:150026889-150026911 CTGGGACATACCTGGGATGGAGG + Intronic
999328780 5:150659251-150659273 CTGCTCCATGCTTGGGGAGAAGG - Intergenic
999921116 5:156322053-156322075 GTGCCACTGACTTGGGGTGGAGG - Intronic
1002187130 5:177459592-177459614 CTGCTACCTACATGGGAGGGAGG + Intronic
1003713012 6:8614485-8614507 CTGCCACATTCCTGGGCTGGTGG - Intergenic
1006929614 6:37679888-37679910 CTGAAACAGACCTGGGGTGGAGG - Intronic
1014485319 6:121992613-121992635 CTGCTACATACAGGTGGTGGGGG - Intergenic
1015147727 6:130006018-130006040 AGGCTACATACTGGGGGTTGGGG + Intergenic
1017950733 6:159132876-159132898 CTGCCACAGGCGTGGGGTGGAGG - Intergenic
1018081730 6:160264700-160264722 CTGCAACAGACTAGGAGTGGTGG + Intronic
1018383494 6:163282254-163282276 CTGCTAATTACTTGGTGGGGTGG - Intronic
1022029710 7:26481223-26481245 CTGCTACATTTCTGGGGTTGGGG - Intergenic
1026501211 7:70944817-70944839 CAGCTCCATACTTGGTGTGAAGG + Intergenic
1026878937 7:73895595-73895617 CTTCTTCATAGTGGGGGTGGAGG - Intergenic
1030675938 7:112385221-112385243 GTTCTACAAACTGGGGGTGGAGG + Intergenic
1031546131 7:123053282-123053304 GTGCTACAGGCCTGGGGTGGTGG - Intergenic
1031843716 7:126778767-126778789 CTGTAACATATTGGGGGTGGGGG - Intronic
1033112186 7:138590032-138590054 CTGCGAGATACTTGGGAAGGTGG + Intergenic
1037882908 8:22581574-22581596 CTGCTCAATACGTGGGGTGGTGG - Intronic
1038758578 8:30365186-30365208 CTACTAGATACTTGGGGTCTTGG + Intergenic
1039050208 8:33485523-33485545 CAGCTCCGGACTTGGGGTGGGGG + Intronic
1039845509 8:41322882-41322904 TTGCAAAAGACTTGGGGTGGGGG + Intergenic
1041807661 8:61870809-61870831 CTACTACATACTTGGTGTAAGGG + Intergenic
1043926190 8:86039837-86039859 CTGGTACCAACTTGGTGTGGCGG - Intronic
1044241512 8:89893486-89893508 TTGCTGCATGCCTGGGGTGGTGG + Intergenic
1046087098 8:109451433-109451455 ATGCTACATACTAGGATTGGGGG - Intronic
1049078484 8:140420472-140420494 CTACAACCTACCTGGGGTGGGGG + Intronic
1049220226 8:141425611-141425633 CTGCGATATCCTTGGGGGGGTGG + Intronic
1049470166 8:142771766-142771788 ATGCTACATAGTGGGGGAGGCGG + Intronic
1049654311 8:143791128-143791150 CTCCCCCAGACTTGGGGTGGGGG - Exonic
1050751688 9:8946329-8946351 CTGCTGCCTCCTTGGGGTGGTGG - Intronic
1051510211 9:17869070-17869092 CAGCTTCATACGTGGCGTGGTGG - Intergenic
1052919042 9:33948456-33948478 CTGCTGTGTACTTGGGGTGGTGG + Exonic
1055605180 9:77961926-77961948 CCTCTACATTCTTGAGGTGGTGG - Intronic
1056110887 9:83393590-83393612 CTGCAACTAACTGGGGGTGGTGG + Intronic
1056749716 9:89339242-89339264 TTCCCACAGACTTGGGGTGGGGG + Intronic
1060206708 9:121686611-121686633 CTGCTTCATCCCTGGGTTGGGGG - Intronic
1061348732 9:130047013-130047035 TTGACACCTACTTGGGGTGGGGG + Intergenic
1062070324 9:134551999-134552021 CTGAAATAGACTTGGGGTGGGGG - Intergenic
1062535411 9:137019061-137019083 CTGCTACATACTTGGGGTGGAGG + Exonic
1189201144 X:39196604-39196626 ATGCTACATCCTTCTGGTGGTGG + Intergenic
1189327184 X:40120031-40120053 CTGCTCCACAGTTGGGGCGGGGG + Intronic
1190322464 X:49187003-49187025 CTTCTCAAGACTTGGGGTGGGGG - Intergenic
1193481080 X:82029819-82029841 CTGCTCTCTACTGGGGGTGGGGG + Intergenic
1197956478 X:131954861-131954883 CTGCTACCTTCCTGGGGAGGTGG - Intergenic