ID: 1062543906

View in Genome Browser
Species Human (GRCh38)
Location 9:137053431-137053453
Sequence CTGGGTATTCAGCCCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062543906_1062543912 5 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543912 9:137053459-137053481 GTGGCTCTAACCGCACCCTCCGG No data
1062543906_1062543915 10 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543915 9:137053464-137053486 TCTAACCGCACCCTCCGGGGCGG No data
1062543906_1062543918 19 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543918 9:137053473-137053495 ACCCTCCGGGGCGGCGGCACAGG No data
1062543906_1062543916 13 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543916 9:137053467-137053489 AACCGCACCCTCCGGGGCGGCGG No data
1062543906_1062543923 29 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543923 9:137053483-137053505 GCGGCGGCACAGGGCAGAAGTGG No data
1062543906_1062543920 20 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543920 9:137053474-137053496 CCCTCCGGGGCGGCGGCACAGGG No data
1062543906_1062543913 6 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543913 9:137053460-137053482 TGGCTCTAACCGCACCCTCCGGG No data
1062543906_1062543914 7 Left 1062543906 9:137053431-137053453 CCCCATCTGGGCTGAATACCCAG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1062543914 9:137053461-137053483 GGCTCTAACCGCACCCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062543906 Original CRISPR CTGGGTATTCAGCCCAGATG GGG (reversed) Intronic
900992655 1:6104997-6105019 CTGTGGACTCAGCCCAGCTGGGG - Exonic
905315033 1:37077004-37077026 CTGGGAACTCAGACCTGATGTGG - Intergenic
907202918 1:52743040-52743062 TTGGGTATACCTCCCAGATGGGG - Intronic
907850282 1:58249328-58249350 GTGGGAATCCAGCCCAGGTGGGG - Intronic
912523105 1:110260014-110260036 CTGGGCATGCATCTCAGATGAGG + Intronic
915008533 1:152663376-152663398 CTGGGGAGTCAGAGCAGATGAGG - Exonic
915010976 1:152686103-152686125 CTGGGGAGTCAGAGCAGATGAGG - Exonic
916692762 1:167206589-167206611 CTGAGTATTCAGCTGAGCTGGGG - Intergenic
918788017 1:188789565-188789587 CTGGCTATTCAGCCTATATTTGG - Intergenic
920540254 1:206772897-206772919 TTGGGTATTCATCCCAGGTTGGG - Intergenic
1063168362 10:3484271-3484293 CTGGTTATTTGGCCCTGATGAGG + Intergenic
1063953863 10:11247916-11247938 CTGGGTCTTCAGAACAGAGGAGG - Intronic
1064298934 10:14104582-14104604 CTGGGGTTACAGCACAGATGGGG - Intronic
1065500296 10:26374722-26374744 CTGGGTATTGAGCATGGATGTGG - Intergenic
1069155016 10:65017926-65017948 CTGGGTATTTACCCCAGACAAGG + Intergenic
1069829669 10:71275059-71275081 CTGGGTTTGCATCCCAGCTGGGG - Intronic
1070519318 10:77238094-77238116 CTGGGAATTCAGATGAGATGAGG + Intronic
1071476820 10:86032310-86032332 CTGGGTACACCTCCCAGATGGGG - Intronic
1072937784 10:99730108-99730130 CTGGGAATACATCCCAGAGGAGG - Intronic
1073206652 10:101772977-101772999 CTGGGGATTCTGGCCAGATGCGG + Intronic
1074234053 10:111566983-111567005 CTGGGTATTCAAAACAGAAGCGG + Intergenic
1074637271 10:115334866-115334888 TTGGGATTTCAGCCCAGATTTGG - Intronic
1075563331 10:123484354-123484376 CTTGGCATCCATCCCAGATGGGG - Intergenic
1076837352 10:133027884-133027906 CGTGGGACTCAGCCCAGATGTGG + Intergenic
1076979751 11:198139-198161 GTGGGTATGCAGCCCAGTTTGGG - Intronic
1078141480 11:8696364-8696386 CTGGTTCTTCAGCCCTGCTGTGG + Intronic
1080053453 11:27880999-27881021 CTGGGTTTGCAGCCCAGCTCTGG - Intergenic
1083738270 11:64694126-64694148 CTGGGGTCTCAGCCCAGCTGTGG - Intronic
1085161715 11:74353845-74353867 CTGGGTACACCTCCCAGATGGGG + Intronic
1087340363 11:96898042-96898064 TCGGGTATTCACCCCAGACGAGG + Intergenic
1088007399 11:104959550-104959572 TTATGGATTCAGCCCAGATGTGG + Intronic
1088907133 11:114163361-114163383 CTGATTTTCCAGCCCAGATGGGG + Intronic
1096262009 12:50098856-50098878 CGGGGTTTTCACCCCTGATGGGG + Intronic
1097228513 12:57495016-57495038 CTGGGTACACCTCCCAGATGGGG + Intronic
1099153354 12:79143504-79143526 ATGGGTGCTCAGCCCTGATGGGG + Intronic
1101429538 12:104615533-104615555 CTGGGATTTCAGCCCACGTGGGG - Intronic
1106551529 13:30775647-30775669 CTGCCTATTCAGCACAGGTGCGG + Intergenic
1107468304 13:40667835-40667857 CTGGACCTGCAGCCCAGATGAGG - Intergenic
1107794959 13:44041900-44041922 CTGGCTATGGAGCGCAGATGGGG - Intergenic
1107980759 13:45732229-45732251 CTGAGTGTTCAGCACAAATGTGG - Intergenic
1108456543 13:50620736-50620758 CTATGTATCCAGCCCAAATGTGG - Intronic
1111379575 13:87430202-87430224 CAGGGTATTCAACCTAGTTGAGG - Intergenic
1118955724 14:70478004-70478026 CTGGGTACACCTCCCAGATGGGG - Intergenic
1119392720 14:74302107-74302129 CTGGGTATCCACCCCAGAGTTGG - Intronic
1119473407 14:74912956-74912978 CAGAGGATTCAGCCCAGGTGAGG + Intronic
1119759776 14:77141975-77141997 ATTGGGATTCAGCCCTGATGTGG + Intronic
1121124849 14:91399382-91399404 ATGGGGATCCAGCCCAGATGTGG - Intronic
1123707539 15:22960760-22960782 CAGGCTTTTCCGCCCAGATGTGG - Intronic
1127470270 15:59283745-59283767 CTGGGTTTGAAGCCCAGCTGTGG - Intronic
1128389549 15:67173903-67173925 CTGGGTGTCCAGCCTCGATGGGG - Intronic
1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG + Intergenic
1130942765 15:88524444-88524466 TTGGGTACTCCTCCCAGATGGGG - Intronic
1132872527 16:2122194-2122216 CTGGGCACCCAGCCCAGGTGAGG - Intronic
1133832585 16:9337787-9337809 GTGGGTATTCAGCTCAGACATGG - Intergenic
1134750071 16:16618904-16618926 CTGGGTACACCTCCCAGATGGGG + Intergenic
1134995404 16:18734735-18734757 CTGGGTACACCTCCCAGATGGGG - Intergenic
1140952019 16:79827409-79827431 CTGAGTATTTAGACCAGATGAGG + Intergenic
1143220331 17:5256095-5256117 AGGGGTCTTCAGCCCAGATCTGG + Intergenic
1144154215 17:12482781-12482803 CTGGAGATACATCCCAGATGTGG + Intergenic
1147551128 17:41442638-41442660 CTGAGAATTCAGTCCAGATTGGG + Intergenic
1148781441 17:50124180-50124202 CTGGGAACTCTGCCCAGCTGGGG + Intronic
1149593088 17:57846400-57846422 TTGGGTACTCCTCCCAGATGGGG - Intronic
1149983075 17:61326781-61326803 ATGGGTCTTCAGCACAGAAGAGG + Intronic
1154507866 18:15060596-15060618 CTGGGTATGCAGCCCTGGTTTGG - Intergenic
1157299503 18:46469299-46469321 CTGGGTTTTGATCCCAAATGAGG - Intergenic
1157585179 18:48796464-48796486 CTGGGCATTCAGGCCAGGTGTGG - Intronic
1158177263 18:54670525-54670547 CTAGGTATCCAGCAGAGATGGGG + Intergenic
1158990502 18:62863877-62863899 CTGGGAATGCAGCCCAGTAGGGG + Intronic
1159361595 18:67411913-67411935 TAGAGTATTCAGGCCAGATGTGG - Intergenic
1164046873 19:21551167-21551189 TTGGGTACACATCCCAGATGGGG + Intronic
1164675489 19:30097789-30097811 AAGGGGCTTCAGCCCAGATGAGG + Intergenic
1166110876 19:40622356-40622378 CTGGGGATTCAGCCCACACTGGG + Intronic
1167504705 19:49865133-49865155 CTGGGGTTTCACCCCAGCTGCGG + Exonic
925192081 2:1892871-1892893 CTGGGCATGCAGACCAGATAGGG + Intronic
926027540 2:9557686-9557708 CTGGTTATTCAGGCCAGGCGCGG - Intergenic
927737138 2:25534528-25534550 CTGGGTACACTTCCCAGATGGGG + Intronic
929332346 2:40698005-40698027 CTGGATATTCAGCAAAGAAGAGG + Intergenic
929899589 2:45989163-45989185 CAGAGCATTCACCCCAGATGGGG - Intronic
929903240 2:46024062-46024084 CTGGGCATTCAGACAAAATGAGG - Intronic
930319568 2:49837186-49837208 CTGGGTATTGAGCCCACAGCAGG - Intergenic
930374017 2:50541213-50541235 CTTTTTATTCAGCTCAGATGGGG + Intronic
932903463 2:75725272-75725294 CTGGGTACCCCTCCCAGATGGGG - Intergenic
936653259 2:114454655-114454677 CTGTGAATTCAGCCCGAATGAGG - Intronic
936852472 2:116917418-116917440 ATGGGAATACAGCACAGATGAGG + Intergenic
936963834 2:118105837-118105859 CTGGTTATAGAGCCAAGATGTGG + Intronic
937129416 2:119496374-119496396 CTGGGAATCCATCCCACATGTGG + Intronic
946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG + Intronic
947751310 2:232534152-232534174 CTTGGTTTTCAGCCCATCTGTGG + Intronic
1168858137 20:1024198-1024220 CTGGGAATTCAGCAGTGATGAGG - Intergenic
1169571349 20:6909477-6909499 CTGGAGATTCATCCCAGATGTGG + Intergenic
1174796515 20:53527198-53527220 CTGGGGACCCAGCCCAGGTGAGG - Intergenic
1175773199 20:61636618-61636640 CGGGGCTTTCAGCCCAGCTGTGG + Intronic
1176155373 20:63617509-63617531 CTGGGGAGTCAGACCAGATCAGG + Intronic
1176790216 21:13311203-13311225 CTGGGTATGCAGCCCTGGTTTGG + Intergenic
1176965160 21:15204610-15204632 CTGGTTATTCTTCTCAGATGGGG + Intergenic
1177524139 21:22270721-22270743 CTGGGTATACAGCCCAGGTTTGG + Intergenic
1178583353 21:33853985-33854007 CTGGGGATTCAGGACAGAAGAGG - Intronic
1178615371 21:34128456-34128478 CTGGGAAATCTGCCCAGAGGAGG + Intronic
1182087906 22:27574072-27574094 CAGGGATTTCAGCCCAGATACGG + Intergenic
1183094544 22:35544269-35544291 CTGGGCCTTCAGCAGAGATGGGG - Intronic
1184714765 22:46274639-46274661 CTGGTAAGTCAGCCCAGGTGTGG + Intronic
951412084 3:22378095-22378117 CAGTGTATCCAGCCCAGATGGGG + Intergenic
953415274 3:42712145-42712167 CTCAGTCCTCAGCCCAGATGAGG - Intronic
960924097 3:122780018-122780040 CTGGGTACACCTCCCAGATGGGG + Intronic
961378114 3:126480450-126480472 CTTGGTATGGAGCCCAGAGGGGG + Intergenic
962467278 3:135672661-135672683 CTGGGAAAGCAGCCCAGAAGTGG + Intergenic
963168024 3:142225107-142225129 CGCGGGATTCAGCCCAGACGAGG + Intronic
965656358 3:170989358-170989380 CTGGGTTTTCAACCCAGCAGGGG - Intergenic
966206594 3:177412716-177412738 CTGGGTACACCTCCCAGATGGGG + Intergenic
966570889 3:181441693-181441715 CAGAGTAAACAGCCCAGATGGGG + Intergenic
968865483 4:3208277-3208299 CTTAGTCTTCAGTCCAGATGAGG + Intronic
969056115 4:4403909-4403931 CCAGGAATTCTGCCCAGATGTGG + Intronic
969381399 4:6801058-6801080 CTGGGTATTGAACCAGGATGTGG + Intronic
970417177 4:15870627-15870649 CCGGGTATTTACCCCAGATGAGG + Intergenic
970937636 4:21593267-21593289 ATGGGCATTCAGCCCAGAAGTGG - Intronic
972939852 4:44182273-44182295 TTGGGTACACTGCCCAGATGGGG - Intronic
974928018 4:68325671-68325693 CTGAGCATTCAGGCCAGGTGTGG - Intronic
976149503 4:82078055-82078077 CTGGGTACACCTCCCAGATGGGG - Intergenic
977170848 4:93760541-93760563 CTGTGTATTCAGCCCTGCAGTGG + Intronic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
982804456 4:159747370-159747392 TTGGGTTTTCTGGCCAGATGTGG + Intergenic
982971549 4:161994384-161994406 CTGGGTATGCACCCCATATTGGG + Intronic
985182813 4:187283229-187283251 CTGGGCATTGAGCCAAGATGTGG - Intergenic
985746373 5:1651283-1651305 CTGGGTGTTCATCCCGGGTGTGG + Intergenic
986503974 5:8430143-8430165 CTGGGTTTTCAGCCCCGGTTTGG + Intergenic
989675287 5:43966035-43966057 CTGGGTTTTCAGCACAAATCGGG - Intergenic
991155631 5:63431609-63431631 CTGGTAAGTAAGCCCAGATGTGG + Intergenic
992015661 5:72572997-72573019 CTGGTTATTCAACCCAGAAAGGG + Intergenic
994423507 5:99554100-99554122 TTGGTTATTGAGCCCAAATGTGG - Intergenic
994635241 5:102338433-102338455 CTAGGAATGCAGCCCAGAAGTGG + Intergenic
998823352 5:146076721-146076743 CTCAGTTTTGAGCCCAGATGTGG + Intronic
1006820217 6:36887375-36887397 GTGGGAATTCACCTCAGATGTGG - Intronic
1007828545 6:44620289-44620311 CTGGGGAGACAGTCCAGATGAGG - Intergenic
1008173277 6:48234886-48234908 CAGTGCAATCAGCCCAGATGGGG - Intergenic
1010500553 6:76594157-76594179 CTTGGTCTACAGCCCAGAGGTGG - Intergenic
1012000860 6:93652814-93652836 CTGGCCAGTCACCCCAGATGAGG + Intergenic
1012253908 6:97010378-97010400 CTGGGTATTCAGCTATGATCTGG - Intronic
1012351333 6:98254558-98254580 CTGGGAGTTCAGCCAGGATGTGG - Intergenic
1015070534 6:129088404-129088426 CTGGGTACACCTCCCAGATGGGG + Intronic
1016536861 6:145116686-145116708 CTGGCTTTTCATACCAGATGTGG + Intergenic
1018577674 6:165276606-165276628 TTGGTTATTAAGCCCTGATGTGG + Intergenic
1018900589 6:168049966-168049988 CGGGGAATACAGCCCAAATGGGG + Intergenic
1019388452 7:771823-771845 TTGGGAACTCAGCCCAGATGTGG - Intronic
1020766265 7:12325197-12325219 CTAGGCAATCAGCCCAGATCAGG - Intergenic
1021609294 7:22442380-22442402 CTGAGTAAACAGCCCAGATGAGG - Intronic
1022347165 7:29527799-29527821 CTGGATATTCAGTCAAGCTGTGG + Intergenic
1024721574 7:52142642-52142664 CTGGGTATTCAGCCAACTTCAGG + Intergenic
1027172672 7:75883809-75883831 CAGGGTCTTCAGCCGAGAGGAGG + Exonic
1030299063 7:107957097-107957119 CTGGATATTCCGGCCAGGTGCGG + Intronic
1033927250 7:146478498-146478520 CTAGGTATTAACCCCACATGTGG + Intronic
1039512795 8:38105232-38105254 CTGGATATTCTGCGCAGAAGAGG - Exonic
1039789618 8:40864562-40864584 CTGGGTACTCACCCCAGTTGTGG + Intronic
1040551825 8:48443905-48443927 CTGGGTATAAAGGCCAGTTGAGG + Intergenic
1041293131 8:56326446-56326468 TTGGGTATTCAGTCCAGTTTTGG - Intergenic
1041920674 8:63179729-63179751 CTGGGTACACCTCCCAGATGGGG + Intronic
1049084425 8:140467413-140467435 ATGCAAATTCAGCCCAGATGAGG - Intergenic
1049480693 8:142821077-142821099 CAGGGTTTACAGCCCAGGTGGGG + Intergenic
1051766410 9:20529151-20529173 CTGGGTATGCAGCCTAGGTTTGG + Intronic
1057716111 9:97497953-97497975 CTGGGTACACTTCCCAGATGGGG + Intergenic
1058425907 9:104874974-104874996 CTGGGTACACCTCCCAGATGGGG - Intronic
1059668865 9:116474825-116474847 CTGGGCATGCAGCCTAGGTGGGG + Intronic
1061945375 9:133905723-133905745 CTGGGGCTGCAGCACAGATGAGG + Intronic
1062446411 9:136597213-136597235 CTGGTTTTTCAGCCCCGCTGGGG - Intergenic
1062543906 9:137053431-137053453 CTGGGTATTCAGCCCAGATGGGG - Intronic
1186457653 X:9722631-9722653 CTGAGTATCCAGCCAAGATAAGG - Intergenic
1188182285 X:27071539-27071561 CTGGGTATTCAGCCAAACTTAGG + Intergenic
1192210902 X:69127116-69127138 TTGGGTAGTCAGCTCAGAGGAGG - Intergenic
1194992132 X:100556144-100556166 CTGGGTACACCTCCCAGATGGGG - Intergenic
1199575287 X:149307799-149307821 CTGAACATTCAGCCCAGGTGAGG - Intergenic
1199579253 X:149344971-149344993 TTGGGTATGTAGCCCAGATATGG - Intergenic
1202041421 Y:20689029-20689051 CTGGGTACTCTTCCCTGATGTGG + Intergenic