ID: 1062545976

View in Genome Browser
Species Human (GRCh38)
Location 9:137063920-137063942
Sequence CAGGCTCACAGGATGTTGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062545972_1062545976 -10 Left 1062545972 9:137063907-137063929 CCTCCTGGGGAGCCAGGCTCACA 0: 3
1: 2
2: 3
3: 71
4: 876
Right 1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG 0: 1
1: 0
2: 4
3: 29
4: 258
1062545961_1062545976 21 Left 1062545961 9:137063876-137063898 CCTATGACGTGCCTGGGAGCTGT 0: 1
1: 2
2: 2
3: 6
4: 78
Right 1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG 0: 1
1: 0
2: 4
3: 29
4: 258
1062545971_1062545976 -9 Left 1062545971 9:137063906-137063928 CCCTCCTGGGGAGCCAGGCTCAC 0: 3
1: 3
2: 1
3: 43
4: 314
Right 1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG 0: 1
1: 0
2: 4
3: 29
4: 258
1062545966_1062545976 10 Left 1062545966 9:137063887-137063909 CCTGGGAGCTGTCTGGGGGCCCT 0: 3
1: 0
2: 7
3: 72
4: 603
Right 1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG 0: 1
1: 0
2: 4
3: 29
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062545976 Original CRISPR CAGGCTCACAGGATGTTGTG TGG Exonic
900242777 1:1624887-1624909 GGGGCTCACAGGATGGTGAGTGG + Exonic
900896173 1:5484446-5484468 CAGGCTCCCAGGATGCTCTGTGG - Intergenic
901230116 1:7637157-7637179 CAGGCAGACAGGGTCTTGTGGGG - Intronic
901608411 1:10477032-10477054 CAGGCTGCCAGCATGTTCTGTGG - Intronic
901930759 1:12595293-12595315 CTGGCTCACATGATGGCGTGAGG + Intronic
902240771 1:15087887-15087909 TAATCTCACAGGATGGTGTGAGG - Intronic
903025958 1:20430218-20430240 CCTGCTCAGAGGCTGTTGTGAGG - Intergenic
903325939 1:22568565-22568587 CCGCCTCTCAGGTTGTTGTGCGG + Intronic
903891411 1:26572805-26572827 CTGCCTCACAGGTTGATGTGAGG - Intronic
905987701 1:42302145-42302167 CAGGCTTACTGCATCTTGTGGGG + Intronic
906240222 1:44238257-44238279 CAGGCAATGAGGATGTTGTGGGG + Intronic
908392349 1:63695283-63695305 CTACCTCACAGCATGTTGTGAGG - Intergenic
910259993 1:85285087-85285109 CAGGCACACTGGCTGTGGTGGGG - Intergenic
911412999 1:97534215-97534237 CATTCTCACAGGATGTTGTCTGG + Intronic
913681062 1:121187091-121187113 CAGCCCCACACCATGTTGTGCGG + Exonic
914032892 1:143974731-143974753 CAGCCCCACACCATGTTGTGCGG + Intergenic
914156554 1:145093235-145093257 CAGCCCCACACCATGTTGTGCGG - Exonic
914379050 1:147100080-147100102 CAGGCTGACTGGAAGTTCTGGGG - Intergenic
915276019 1:154788701-154788723 CTGGCTCACAGGAGGCTGTGGGG - Intronic
915613496 1:157015350-157015372 GACGCTCACAGGCTGTTATGAGG + Intronic
916062773 1:161112193-161112215 CTGCCTCACAGAATGTTGTAAGG + Intronic
916602302 1:166304857-166304879 CTGGCTCACAGGATTCTGTAGGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920468374 1:206205615-206205637 CAGCCCCACACCATGTTGTGCGG + Intronic
921971894 1:221158844-221158866 CTACCTCACAGGATTTTGTGAGG - Intergenic
922618217 1:226975744-226975766 CTGCCTCACAGGCTGTCGTGCGG - Intronic
922776366 1:228215923-228215945 CAGGCTGACAGGGTGTCCTGGGG - Intronic
923669698 1:236029811-236029833 CAGGCTCACAGTGTGGAGTGGGG + Intronic
1063902364 10:10747584-10747606 CAGCCTCAGAGGATGCTCTGAGG + Intergenic
1065284222 10:24171955-24171977 CAACCTCAGAGGATGTTGTGAGG - Intronic
1065472353 10:26095319-26095341 CAGGCTCACAGGCTGGGGTTGGG - Intronic
1067460241 10:46452823-46452845 CAGGGTCAGAGGAGGTGGTGTGG - Intergenic
1067626949 10:47931780-47931802 CAGGGTCAGAGGAGGTGGTGTGG + Intergenic
1068661523 10:59627841-59627863 CAGGATCAAAGGATGCTGTGTGG - Intergenic
1070342604 10:75511404-75511426 CAGTCCCACAGTATGTTGAGGGG - Intronic
1070810575 10:79295788-79295810 CTGACTCACAGGATGTCATGTGG + Intronic
1071193903 10:83134753-83134775 CAGGCAAACAGGATCTGGTGTGG - Intergenic
1071898176 10:90087329-90087351 CAGGATCACAGCATGTAGTAGGG - Intergenic
1072292171 10:93974239-93974261 GAGTCTGAGAGGATGTTGTGAGG + Intergenic
1074851352 10:117442012-117442034 CAGGCACACAGGATGGTGACTGG - Intergenic
1075188150 10:120282000-120282022 CAGGCTCAGAGGAGGTCATGAGG - Intergenic
1076359075 10:129874304-129874326 CAGGCACAAAGGATGTCGAGGGG + Intronic
1076407022 10:130219177-130219199 CCGCCTCCCAGGCTGTTGTGAGG - Intergenic
1078077397 11:8174377-8174399 CAGTCTCAAAGGATGCTTTGGGG - Intergenic
1078509916 11:11977436-11977458 CAGGCTGAAAGAATGTTGGGAGG - Intronic
1078615326 11:12860048-12860070 GATGGTCACAGGATGGTGTGTGG + Intronic
1079326490 11:19497221-19497243 CTGCCTCACAGGTTGTTATGAGG + Intronic
1079365269 11:19803566-19803588 CTGCCTCAAAGGATATTGTGAGG + Intronic
1079987279 11:27212394-27212416 CAAGGTTACAGGATGTTGTGTGG - Intergenic
1080520128 11:33061276-33061298 CCACCTCACAGGCTGTTGTGAGG - Intronic
1081820884 11:45993581-45993603 GGGGCTCACAGGAGGTTGGGTGG + Intronic
1082798184 11:57393842-57393864 CTGGCACCCAGGATGTTGTAGGG - Intronic
1083053531 11:59797954-59797976 CTGTCTCAAAGGATGTTGTAAGG - Intronic
1084046238 11:66569299-66569321 CAGCGTCTCAGGCTGTTGTGAGG + Intergenic
1084097001 11:66918040-66918062 AGGGCTCACAGGCTGCTGTGGGG - Intronic
1084266208 11:68006642-68006664 CTGGCTCACAGGATGGTGGGAGG + Intergenic
1084337516 11:68468874-68468896 CTGGCACACAGGACGTTGTAGGG + Intronic
1085225812 11:74920132-74920154 TAGGCGCACAGGATGTTGTCAGG - Intronic
1086961465 11:92983110-92983132 CAGCCTCCCAGGTTGTTGTGAGG + Intronic
1087777542 11:102270010-102270032 CAGGCTCGCAGGCTGGTTTGGGG + Intergenic
1087912964 11:103774612-103774634 TAGGATCACAGGAGGTTGTGTGG + Intergenic
1088313819 11:108487343-108487365 CAGGTTCTCAGGATGTCCTGAGG + Intronic
1089980682 11:122769587-122769609 CATCCTCACAGGATGCTCTGAGG - Intronic
1090963282 11:131575854-131575876 CAGGCTCACTGGGTGCTCTGTGG + Intronic
1091580516 12:1785431-1785453 GAGGCTTCCAGGATGGTGTGTGG - Intronic
1091848453 12:3676281-3676303 CACACACACAGCATGTTGTGGGG + Intronic
1092114057 12:5985808-5985830 CAGGCTGAAAGGAGGTTGTGAGG + Intronic
1093130819 12:15390090-15390112 CAATCTCACAGGATTTTCTGGGG + Intronic
1094495128 12:30984497-30984519 CTGGGTCTCAGGTTGTTGTGTGG - Intronic
1095722663 12:45417603-45417625 CAGGCACACAGGAAGTTCTCAGG + Intronic
1095978336 12:47955052-47955074 CAGGCTTACATGATTTTGAGGGG + Intergenic
1097446950 12:59683174-59683196 CAGTCTCACAGGATGTTGACAGG - Intronic
1098167156 12:67710370-67710392 CAGCCTCACAGGCTGGGGTGAGG + Intergenic
1099275908 12:80575949-80575971 AAGGCTCAAAGGATGGTGTGAGG - Intronic
1101882786 12:108637373-108637395 CAGGCTCACACGGTGTTGCGAGG - Intergenic
1104216292 12:126736961-126736983 CAGGTGCATAGAATGTTGTGAGG + Intergenic
1104340958 12:127948001-127948023 CAGGCTCCCTTGCTGTTGTGTGG + Intergenic
1104612709 12:130242673-130242695 CCGGATCACAGGAGGCTGTGTGG - Intergenic
1104706954 12:130954796-130954818 CAGGGTCACAGTGTGTGGTGAGG - Intronic
1104769646 12:131353278-131353300 CAGGCCTGCAGGTTGTTGTGAGG - Intergenic
1106232943 13:27835923-27835945 CAGACTCACAGGCAGTTGTGAGG + Intergenic
1108127609 13:47261467-47261489 AATGCTCACAGGATGATGAGAGG - Intergenic
1112725977 13:102304872-102304894 CAGGCTCAGAGTCTTTTGTGAGG - Intronic
1113751220 13:112777738-112777760 AAGGCTGCCAGGATGCTGTGCGG + Intronic
1114841976 14:26274278-26274300 TATGCTCTCACGATGTTGTGAGG - Intergenic
1115276960 14:31620572-31620594 CAGGCAAACAGGATCTGGTGTGG - Intronic
1116185356 14:41593411-41593433 TAGGCACACAGGATAATGTGAGG - Intergenic
1117006583 14:51426823-51426845 CTGGCTCGCAGGCTGTTGTGAGG + Intergenic
1118866889 14:69711308-69711330 CAGGCCCACAGGAGCTGGTGGGG - Exonic
1120756447 14:88248944-88248966 TAACCTCACAGGATTTTGTGAGG - Intronic
1120780581 14:88482283-88482305 CAGGCTCAGGGAATATTGTGTGG + Intronic
1122197103 14:100096489-100096511 CACCCTCACAGTGTGTTGTGAGG - Intronic
1122724860 14:103743753-103743775 CTGGCTCAGACGTTGTTGTGAGG - Intronic
1123891226 15:24781671-24781693 CAAGCTCACAGATTGTTGTTAGG - Intergenic
1124592067 15:31062324-31062346 GAGCCTCAGAGGGTGTTGTGTGG + Intronic
1124836818 15:33203424-33203446 CAGGGTCTCACTATGTTGTGCGG + Intergenic
1125684759 15:41557887-41557909 CAGGCTCACTGGATCTTTTCAGG - Intronic
1126267598 15:46773156-46773178 CAGGGCCACTGCATGTTGTGGGG + Intergenic
1126990739 15:54373476-54373498 CAGGCACACTGGCTGTGGTGGGG + Intronic
1127508640 15:59618959-59618981 CAGGCTCTCAAGATGTTGAATGG + Exonic
1127979885 15:64026678-64026700 CTGGCTCACAGGATTTTCTCAGG - Intronic
1128450609 15:67804049-67804071 CACGGTCACAGGATCCTGTGAGG - Intronic
1129186627 15:73911232-73911254 CAGCATAACAGGATATTGTGTGG - Intergenic
1129850137 15:78789104-78789126 CAGGCTCCCAGAACGTTCTGTGG - Intronic
1130556515 15:84926768-84926790 CAGGCTCTCTGGATGCTGTGTGG + Intronic
1135056731 16:19238261-19238283 CCAGCTCACAGGCTATTGTGGGG + Intronic
1135280549 16:21150755-21150777 CGGGCTGCCAGGATGTTGTTTGG - Intronic
1136616175 16:31399844-31399866 CCGCCACCCAGGATGTTGTGAGG - Intronic
1137578291 16:49618235-49618257 ACGTCTCACAGGGTGTTGTGAGG + Intronic
1138222788 16:55267155-55267177 CAGCCTCACAGGGTCTCGTGTGG + Intergenic
1138810077 16:60139414-60139436 CAGGCTCACTGGCTCCTGTGGGG + Intergenic
1139648596 16:68349932-68349954 CAGGCTCCCAGGAATTTGGGAGG - Intronic
1143685047 17:8507051-8507073 AAGGCATACAGGTTGTTGTGAGG - Intronic
1144058818 17:11563200-11563222 CGTGTTCACAGGCTGTTGTGTGG + Exonic
1145217314 17:21061718-21061740 CGGGCTCCCGGGATGTGGTGGGG + Intergenic
1145981400 17:29014258-29014280 CTAGCTCATAGGTTGTTGTGAGG - Intronic
1148611213 17:48965798-48965820 CTACCTCATAGGATGTTGTGAGG - Intronic
1150805321 17:68314204-68314226 CTACCTCACAGGATGTTGTGAGG + Intronic
1153364260 18:4236186-4236208 CTGCCTCATAGGATTTTGTGAGG + Intronic
1153967224 18:10192757-10192779 CTGCCTCACAGGTTGCTGTGAGG + Intergenic
1154332953 18:13444655-13444677 CATGCTCATAGGATGCTGGGAGG - Intronic
1157181140 18:45499141-45499163 CAGACTCACTGGTTGTTTTGGGG + Intronic
1159645704 18:70916047-70916069 CAGGCTAACAGGATCTGGAGTGG - Intergenic
1160968322 19:1756196-1756218 CAGGCTCCCAGGGGGTTGTCTGG - Intronic
1161048991 19:2152028-2152050 CCATTTCACAGGATGTTGTGAGG - Intronic
1161196427 19:2989052-2989074 CAGGGTCCCAGGATCTTGGGAGG - Exonic
1161303444 19:3554479-3554501 CTGCCTCACAGGCTGCTGTGAGG + Intronic
1161347956 19:3777469-3777491 CAGGCTTAAAGGATCTTGGGAGG - Intergenic
1162020695 19:7867145-7867167 CCTGGTCACAGGATGGTGTGAGG + Intergenic
1162558393 19:11401870-11401892 CAAGGTCACAGGTTGTAGTGGGG + Intronic
1166052339 19:40267800-40267822 GAGGCTCACAGTCTGGTGTGAGG + Intronic
1166709059 19:44925571-44925593 CAGGCTGACACGTGGTTGTGGGG + Intergenic
1167360570 19:49028373-49028395 CAGGCTTCCAGAATGTTGTAGGG - Intronic
1167363078 19:49040427-49040449 CAGGCTTCCAGAATGTTGTAGGG + Intergenic
1167365489 19:49053159-49053181 CAGGCTTCCAGAATGTTGTAGGG - Intergenic
1167367673 19:49063659-49063681 CAGGCTTCCAGAATGTTGTAGGG - Intronic
1168188925 19:54724430-54724452 GCAGCACACAGGATGTTGTGAGG - Intergenic
925515432 2:4675494-4675516 CAGGCACACTGGCTGTGGTGTGG - Intergenic
925741832 2:7012074-7012096 AAGACTCTCAGGATATTGTGCGG - Intronic
926006520 2:9377302-9377324 CTGGCTCACAGGATGAGGCGAGG - Intronic
926373233 2:12201689-12201711 CAGGCTCACAGCATTTTTTAAGG + Intergenic
928080747 2:28310269-28310291 CAGGCTGAGAGGATGGTGAGTGG - Intronic
928627606 2:33156525-33156547 CTGCCTCATAAGATGTTGTGAGG + Intronic
929777432 2:44937934-44937956 CCGGCTCCCAGGATGTCGGGAGG - Intergenic
931657915 2:64526845-64526867 CTGCCTTACAGGTTGTTGTGTGG - Intronic
932491545 2:72126259-72126281 CAACCTCACAGGAAGTGGTGAGG + Intergenic
932622979 2:73277074-73277096 CTGGCTAGCAGGATGCTGTGAGG - Intronic
932787442 2:74619417-74619439 GAGGCTCAAAGGATGCTCTGAGG + Intronic
932840571 2:75078370-75078392 CCTCCTCACAGGAGGTTGTGAGG + Intronic
933725445 2:85424281-85424303 CAGGCCAACAGGAGGTTATGTGG - Intronic
933775171 2:85767365-85767387 CTGGCTCCCAGGCTGTGGTGTGG - Intronic
933890642 2:86766220-86766242 AAGGCTCTCAGGATCCTGTGAGG - Intronic
935631549 2:105216453-105216475 TGGCCTCACAGGATGCTGTGTGG + Intergenic
936098386 2:109552275-109552297 CAGTCTCTCAGGATGTAGTTAGG - Intronic
937268075 2:120629807-120629829 GAGGCTCAGAGGCTGTTGTCTGG - Intergenic
937487987 2:122335680-122335702 CAGGCTCTCCAGATGCTGTGTGG - Intergenic
938606858 2:132903072-132903094 CTGGATCACAGGTTGTTGTGAGG + Intronic
940322858 2:152395679-152395701 CAGGCTCACATGAAATTGAGAGG + Intronic
940582466 2:155600042-155600064 CAGGCACACTGGCTGCTGTGGGG + Intergenic
941406819 2:165100109-165100131 CAGGCTCTCAGAATTTTGGGAGG - Intronic
942459674 2:176160344-176160366 CAGGGTCAGAGGTCGTTGTGGGG + Intronic
943247575 2:185474354-185474376 CAGGCACACAGGCTGCTGTGTGG - Intergenic
945423862 2:209674404-209674426 CTGTCTCAGAGGTTGTTGTGGGG - Intronic
945725011 2:213464753-213464775 CTGGCTCAAAGGTTGTTGTCAGG - Intronic
946749237 2:222876778-222876800 GAAGCTCACAGTCTGTTGTGGGG + Intronic
947461197 2:230306234-230306256 CAGGTTCCCAGGATGCAGTGGGG - Intronic
1169227203 20:3864269-3864291 CAGGCCCACGGGATGGTGTGAGG - Exonic
1170459813 20:16566951-16566973 CAGGTAGACAGGGTGTTGTGAGG - Intronic
1171091820 20:22292569-22292591 CAGGATCACAGTATGTCCTGGGG - Intergenic
1171339730 20:24418328-24418350 CAGGCCCACAGGATGTAGGCTGG + Intergenic
1172481468 20:35274346-35274368 CAGTCACGCAGGATGTTGCGCGG - Exonic
1173260230 20:41428051-41428073 CAGGCTCCCAGCTTGGTGTGAGG + Intronic
1174176020 20:48645567-48645589 CATGCTGACACGATGTTGTCAGG - Intronic
1174189667 20:48731330-48731352 AAGGGTGACAGGATGTTTTGAGG - Intronic
1174958750 20:55131438-55131460 CAGTCACTCTGGATGTTGTGAGG + Intergenic
1175219306 20:57407826-57407848 CAGCCTGACAGGATGCAGTGAGG + Exonic
1175867040 20:62184390-62184412 CATGCTCACAGGAGGATTTGAGG + Intronic
1176123432 20:63464469-63464491 CAGGTCCCCAGGATGATGTGTGG - Intronic
1178872860 21:36390629-36390651 CTACCTCACAGGCTGTTGTGAGG - Intronic
1181635285 22:24171605-24171627 CAGGCGCACAGGATGTCCTGTGG + Intronic
1184470075 22:44691271-44691293 CAGGGTCACAGGCTGGTGAGGGG - Intronic
950480491 3:13240643-13240665 CCTGCTCTCAGGATGTTCTGTGG - Intergenic
950626988 3:14254497-14254519 GAGGAACACAGGGTGTTGTGGGG - Intergenic
950696541 3:14705057-14705079 CAGGCTCCAAGGATGTTGATAGG - Intronic
950964493 3:17136901-17136923 CAGAATCACAGCATGTTGAGAGG + Intergenic
951163891 3:19461508-19461530 CAGTCACACAGGATTTTCTGTGG + Intronic
955983543 3:64550582-64550604 CAAACTCATAGGATGCTGTGAGG - Intronic
956256818 3:67292050-67292072 CAAGCTCATGGGTTGTTGTGAGG - Intergenic
957636462 3:82791437-82791459 CAGGCACACTGGCTGTGGTGGGG - Intergenic
958991564 3:100851896-100851918 CAGGCTCATCTGATGTTGTAGGG + Exonic
959281620 3:104348532-104348554 CAGGACCACTGGATGTTGAGTGG - Intergenic
962012002 3:131400893-131400915 CATTCTCACAGGATGGTGTGAGG + Intergenic
962069020 3:132013736-132013758 CCAGCTCATAGGTTGTTGTGAGG - Intronic
962211897 3:133486481-133486503 CAGGCACACTGGCTGTGGTGGGG + Intergenic
963913213 3:150832710-150832732 AAGGCTCCCAGGGTGTCGTGGGG + Intergenic
967250609 3:187534212-187534234 CAGTCTCACTGCATGTAGTGTGG + Intergenic
968682544 4:1931110-1931132 CAGGCTTACATGATGTGGTAGGG + Intronic
968743787 4:2346543-2346565 CAGACTCACACTATGTTGTTAGG - Intronic
970938209 4:21599860-21599882 CAGGCCCAAAGGAAGTTGTAGGG + Intronic
971764826 4:30817253-30817275 CTATCTCATAGGATGTTGTGAGG + Intronic
975124025 4:70761558-70761580 CTGTCTCACAGCATGTTGTAAGG + Intronic
976121787 4:81791347-81791369 CAGCCTCCCAAGATGTTGGGTGG + Intronic
977042833 4:92036060-92036082 CAGGACCACTGCATGTTGTGGGG + Intergenic
979435425 4:120683117-120683139 CCTGCTCACAGAATGTTGGGTGG + Intergenic
981569936 4:146141311-146141333 CTGTCTCACAGAATGTTCTGTGG + Intergenic
982506651 4:156227101-156227123 CAGGGTCACAGGATGTAATATGG - Intergenic
982963020 4:161864406-161864428 TAACCTCACAGGTTGTTGTGAGG + Intronic
984443470 4:179803822-179803844 CAAGCTGACTGGATGTTGTAAGG - Intergenic
984653290 4:182291547-182291569 CAGTCTCACAGGAGGCTGTGAGG - Intronic
984874996 4:184359648-184359670 CAAACTCACAAGATGTTGTCAGG - Intergenic
985746801 5:1652588-1652610 CAGCCTCGCAGGATGCTGTGAGG + Intergenic
985875031 5:2587751-2587773 CAGGCTCACTGGCTGTTGGCAGG - Intergenic
985900245 5:2783075-2783097 CAGGTTCCCAGGATGGTGTCAGG + Intergenic
986419391 5:7563395-7563417 CAGGCTCACAGAAGCTTCTGTGG - Intronic
989323732 5:40165878-40165900 CAGAGTCAGAGGAGGTTGTGGGG - Intergenic
991096414 5:62744654-62744676 CATTCTCACAAGTTGTTGTGAGG - Intergenic
991303797 5:65154678-65154700 TCTGCTCATAGGATGTTGTGAGG + Intronic
992006811 5:72486462-72486484 GAGGTACACAGGATGTTGGGAGG - Intronic
992275111 5:75107859-75107881 CAGGCTCACAGAACTTAGTGGGG - Intronic
993457020 5:88139187-88139209 CAGGGTTACAGGATATTGGGAGG + Intergenic
995500585 5:112801304-112801326 CCGGCTCACATGATGCTGAGCGG + Exonic
997710672 5:136001454-136001476 CAGGCCCACAGGTTCTGGTGTGG + Intergenic
998416463 5:141949790-141949812 CCACCTCACAGGGTGTTGTGAGG + Intronic
1000833164 5:166128156-166128178 CTGGCTTACAGGCTGCTGTGGGG + Intergenic
1004575759 6:16891890-16891912 CATGCTCTCAGGACCTTGTGGGG + Intergenic
1005590448 6:27319779-27319801 CTACCTCACAGGATTTTGTGAGG + Intergenic
1005813905 6:29535182-29535204 CTGTCTCACAGGATATAGTGAGG - Intergenic
1006677008 6:35771663-35771685 CTGGTTCAGAGTATGTTGTGTGG + Intergenic
1007387242 6:41528234-41528256 CCGGCTGACAGGATGCTGAGCGG - Intergenic
1007423283 6:41732678-41732700 CCACCTCACAGGCTGTTGTGAGG - Intronic
1011321826 6:86104146-86104168 CAGGCTTACTGGCTCTTGTGAGG + Intergenic
1012234493 6:96797558-96797580 TATCCTTACAGGATGTTGTGAGG - Exonic
1015199079 6:130558923-130558945 CAGGGTCTCACTATGTTGTGTGG + Intergenic
1018172206 6:161152116-161152138 CTGCCTGCCAGGATGTTGTGGGG + Intronic
1018199530 6:161382244-161382266 AAAGCTTACAGGATGTAGTGGGG + Intronic
1018312482 6:162525359-162525381 CAGGCTCAGGGGAGGTTGGGTGG - Intronic
1019351377 7:555656-555678 CAGGGCCCCAGCATGTTGTGGGG + Intronic
1020013728 7:4819572-4819594 GAGGCGCACACGATGGTGTGAGG + Intronic
1020761062 7:12269105-12269127 CAGGCTCCCAGGACGCAGTGGGG - Intergenic
1022181973 7:27929404-27929426 CAGGCTCACAGAATGAAGTGAGG + Intronic
1022792780 7:33705324-33705346 CAGCCACACAGGATCCTGTGAGG + Intergenic
1022792781 7:33705327-33705349 AAGCCTCACAGGATCCTGTGTGG - Intergenic
1023869507 7:44255506-44255528 TAGGGTCACAGGAAGTGGTGTGG - Intronic
1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG + Intergenic
1023956540 7:44891230-44891252 CAGGCTCAGAGAGGGTTGTGTGG + Intergenic
1025262119 7:57426433-57426455 CAGGTTCACAGGTTGTTTTGTGG - Intergenic
1025615338 7:63112893-63112915 CAGGCTCACACACTGTTGTGTGG + Intergenic
1025739456 7:64183651-64183673 CAGGCTCACAGGTTGTTTTGTGG - Intronic
1026000817 7:66558095-66558117 CAGGCTCACAGGTTGTTCTGTGG - Intergenic
1027126908 7:75563050-75563072 GAGGCTCGCAGGAAGTTGGGTGG + Exonic
1028017793 7:85736821-85736843 CAGGCTCACTGTCTCTTGTGGGG - Intergenic
1028596153 7:92547665-92547687 CAGGCACACTGGCTGTGGTGGGG - Intergenic
1029957121 7:104651874-104651896 CAGGCTCACAGGCTATTGTGAGG + Intronic
1032486139 7:132288893-132288915 CTGCCTCCCAGGATGTTCTGAGG - Intronic
1033186682 7:139232264-139232286 CAGGGCCCCAGGATTTTGTGTGG - Intronic
1033282856 7:140018025-140018047 GATCCTCACAGGATGTTGAGAGG - Intronic
1034228004 7:149497730-149497752 CCGGCTCCCAGGATGCAGTGTGG - Exonic
1034868846 7:154664684-154664706 CAAGATCACAGTATGTTGGGAGG + Intronic
1034893159 7:154858216-154858238 CTGCCTCACAGGCTGTTGAGAGG - Intronic
1035746682 8:1966207-1966229 GGGGCTCTCAGGATGGTGTGGGG + Intergenic
1037914354 8:22763603-22763625 CTGCCTCACAGGGTGTTGTGAGG + Intronic
1039798160 8:40932909-40932931 CAGGCCCACAGGAGGTGCTGCGG - Intergenic
1039915676 8:41858758-41858780 CAGCTTCACAGTTTGTTGTGTGG + Intronic
1040287601 8:46108395-46108417 GAGGCTCACAGCATTTTCTGGGG + Intergenic
1044746882 8:95379181-95379203 CTATCTCAGAGGATGTTGTGAGG + Intergenic
1044997588 8:97851974-97851996 CAGTCATAAAGGATGTTGTGGGG - Exonic
1045018556 8:98020805-98020827 TTGTCTCACAGGGTGTTGTGAGG + Intronic
1047445032 8:124912152-124912174 CCTGCTCCCAGGAGGTTGTGGGG - Intergenic
1048609762 8:136009627-136009649 CAGGCCCACAGAAGGATGTGTGG - Intergenic
1049774995 8:144400066-144400088 CAGGCACCCAGGAGGGTGTGCGG - Exonic
1050783387 9:9368279-9368301 GAGCCTCACAGGATTTTATGAGG + Intronic
1051595543 9:18821322-18821344 CAGGGTCACAGGATGCTGGTGGG + Intronic
1051910893 9:22153991-22154013 CAGACTCACAGGTTGTTGTGTGG - Intergenic
1052344149 9:27391198-27391220 CACGTTCACAGGATGGTGTTTGG + Intronic
1052899702 9:33781880-33781902 CAGGCTTACAGGGTGTGGAGAGG + Intronic
1053124623 9:35570202-35570224 CAGGCACATAGGAATTTGTGGGG + Intergenic
1053299965 9:36941853-36941875 CAGGCTCACTGGATGATGCAGGG + Intronic
1055990611 9:82101992-82102014 CAGAGTCAGAGGAGGTTGTGGGG + Intergenic
1056424312 9:86461447-86461469 CTGCCTCACGGGTTGTTGTGAGG + Intergenic
1058412051 9:104744520-104744542 CAGGCTCACAAGATTTTGAAAGG + Intergenic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1059726197 9:117010692-117010714 CAGGCATTCAGGATGTTTTGGGG + Intronic
1059945154 9:119402072-119402094 CTGGCACACAGGAGGTGGTGAGG + Intergenic
1061058375 9:128237113-128237135 CAAGCTCACAGGAAGCAGTGGGG + Intronic
1061214844 9:129215754-129215776 CCACCTCCCAGGATGTTGTGTGG + Intergenic
1062286767 9:135776672-135776694 CAGGCTCCCAGCATATTCTGTGG + Intronic
1062314114 9:135957217-135957239 CAGGCTGAGGGGATGTTGGGGGG + Intronic
1062510332 9:136901880-136901902 CAGGCTCACAGGGTGGGGAGTGG - Intronic
1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG + Exonic
1188756328 X:33968663-33968685 CAGGCCTCCAGGATGTGGTGGGG - Intergenic
1190406393 X:50091951-50091973 CAGGCAAATAGGATGATGTGTGG - Intronic
1197902551 X:131389703-131389725 CACGCTCAATGGATGTTGTAAGG + Intronic