ID: 1062547200

View in Genome Browser
Species Human (GRCh38)
Location 9:137069165-137069187
Sequence CCAAGGCAGGCACTGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062547180_1062547200 26 Left 1062547180 9:137069116-137069138 CCTCTGGGAGCTTGGCCCCCCAA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547184_1062547200 8 Left 1062547184 9:137069134-137069156 CCCAACCCCAGCCATAATACAGG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547181_1062547200 11 Left 1062547181 9:137069131-137069153 CCCCCCAACCCCAGCCATAATAC 0: 1
1: 0
2: 0
3: 28
4: 255
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547178_1062547200 28 Left 1062547178 9:137069114-137069136 CCCCTCTGGGAGCTTGGCCCCCC 0: 1
1: 0
2: 4
3: 18
4: 174
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547189_1062547200 1 Left 1062547189 9:137069141-137069163 CCAGCCATAATACAGGTCCTGTT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547179_1062547200 27 Left 1062547179 9:137069115-137069137 CCCTCTGGGAGCTTGGCCCCCCA 0: 1
1: 0
2: 2
3: 12
4: 197
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547187_1062547200 3 Left 1062547187 9:137069139-137069161 CCCCAGCCATAATACAGGTCCTG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547186_1062547200 7 Left 1062547186 9:137069135-137069157 CCAACCCCAGCCATAATACAGGT 0: 1
1: 0
2: 2
3: 7
4: 148
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547188_1062547200 2 Left 1062547188 9:137069140-137069162 CCCAGCCATAATACAGGTCCTGT 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547190_1062547200 -3 Left 1062547190 9:137069145-137069167 CCATAATACAGGTCCTGTTCCCA 0: 1
1: 0
2: 0
3: 14
4: 111
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547183_1062547200 9 Left 1062547183 9:137069133-137069155 CCCCAACCCCAGCCATAATACAG 0: 1
1: 0
2: 2
3: 18
4: 237
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data
1062547182_1062547200 10 Left 1062547182 9:137069132-137069154 CCCCCAACCCCAGCCATAATACA 0: 1
1: 0
2: 7
3: 63
4: 757
Right 1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062547200 Original CRISPR CCAAGGCAGGCACTGGGTTG GGG Intronic
No off target data available for this crispr