ID: 1062550853

View in Genome Browser
Species Human (GRCh38)
Location 9:137085955-137085977
Sequence GCGTGTCTGGAGAGCTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062550853_1062550863 29 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550863 9:137086007-137086029 CAGCGGATTCGCCCAAGGGCAGG No data
1062550853_1062550856 2 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550856 9:137085980-137086002 AAATGCCACAGTCAGGACCGTGG No data
1062550853_1062550861 24 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550861 9:137086002-137086024 GGACGCAGCGGATTCGCCCAAGG No data
1062550853_1062550855 -5 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550855 9:137085973-137085995 CACGCAGAAATGCCACAGTCAGG No data
1062550853_1062550862 25 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550862 9:137086003-137086025 GACGCAGCGGATTCGCCCAAGGG No data
1062550853_1062550859 12 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550859 9:137085990-137086012 GTCAGGACCGTGGGACGCAGCGG No data
1062550853_1062550857 3 Left 1062550853 9:137085955-137085977 CCGGGGGAGCTCTCCAGACACGC No data
Right 1062550857 9:137085981-137086003 AATGCCACAGTCAGGACCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062550853 Original CRISPR GCGTGTCTGGAGAGCTCCCC CGG (reversed) Intergenic