ID: 1062551026

View in Genome Browser
Species Human (GRCh38)
Location 9:137086557-137086579
Sequence AGTCCCAGCGTCCCGCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062551026_1062551032 16 Left 1062551026 9:137086557-137086579 CCGAGGCGCGGGACGCTGGGACT No data
Right 1062551032 9:137086596-137086618 GCCCCGCCCGGGCGCCTCCCCGG No data
1062551026_1062551027 -9 Left 1062551026 9:137086557-137086579 CCGAGGCGCGGGACGCTGGGACT No data
Right 1062551027 9:137086571-137086593 GCTGGGACTCTCTGCCAACATGG No data
1062551026_1062551034 17 Left 1062551026 9:137086557-137086579 CCGAGGCGCGGGACGCTGGGACT No data
Right 1062551034 9:137086597-137086619 CCCCGCCCGGGCGCCTCCCCGGG No data
1062551026_1062551029 4 Left 1062551026 9:137086557-137086579 CCGAGGCGCGGGACGCTGGGACT No data
Right 1062551029 9:137086584-137086606 GCCAACATGGCGGCCCCGCCCGG No data
1062551026_1062551031 5 Left 1062551026 9:137086557-137086579 CCGAGGCGCGGGACGCTGGGACT No data
Right 1062551031 9:137086585-137086607 CCAACATGGCGGCCCCGCCCGGG No data
1062551026_1062551028 -6 Left 1062551026 9:137086557-137086579 CCGAGGCGCGGGACGCTGGGACT No data
Right 1062551028 9:137086574-137086596 GGGACTCTCTGCCAACATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062551026 Original CRISPR AGTCCCAGCGTCCCGCGCCT CGG (reversed) Intergenic