ID: 1062552566

View in Genome Browser
Species Human (GRCh38)
Location 9:137096580-137096602
Sequence GGTCCCCGATAATGTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062552562_1062552566 27 Left 1062552562 9:137096530-137096552 CCTTAGATTACAGAATCGAATTT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1062552566 9:137096580-137096602 GGTCCCCGATAATGTCCTCATGG 0: 1
1: 0
2: 1
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062552566 Original CRISPR GGTCCCCGATAATGTCCTCA TGG Intronic
902752858 1:18529382-18529404 GTTCCCCCATACTGTTCTCACGG + Intergenic
903796245 1:25930960-25930982 GTTCCCCCATACTGTTCTCATGG + Intergenic
904003335 1:27350657-27350679 GGTCCCCATTAATGCCCTTAGGG + Intronic
905333819 1:37229484-37229506 GTTCCCCCATATTGTCCTCGTGG - Intergenic
908593666 1:65661060-65661082 GTTCCCCCATACTGTTCTCATGG - Intergenic
908853524 1:68397133-68397155 TTTCCCCCATACTGTCCTCATGG - Intergenic
909407808 1:75312065-75312087 TTTCCCCCATACTGTCCTCATGG + Intronic
910642588 1:89480084-89480106 GTTCCCCCATACTGTTCTCATGG - Intergenic
912167346 1:107056883-107056905 GGTCCGCGATCATCTCCTCGTGG - Exonic
912579005 1:110703737-110703759 GTTCCCTCATAATGTTCTCATGG - Intergenic
916035671 1:160920655-160920677 TTTCCCCCATAATGTTCTCATGG + Intergenic
916184798 1:162120663-162120685 GTTCCCCCATACTGTTCTCATGG - Intronic
919064099 1:192670991-192671013 GTTCCCCCATACTGTTCTCATGG + Intergenic
919414953 1:197296751-197296773 GTTCCCCCATACTGTTCTCATGG + Intronic
919593452 1:199532674-199532696 TTTCCCCCATACTGTCCTCATGG + Intergenic
920842573 1:209567067-209567089 TGTCCCCCATACTGTTCTCACGG - Intergenic
921528354 1:216246661-216246683 GGTCCCAGGTAATGTCCCCAAGG + Exonic
922430242 1:225545085-225545107 AGCCCTCCATAATGTCCTCATGG + Intronic
1063380026 10:5578494-5578516 GGTTCCCGATAATGGCCTTGGGG - Intergenic
1065217449 10:23462935-23462957 GGTCCCACAGAATGTCCACAAGG + Intergenic
1066018441 10:31271908-31271930 TTTCCCCGATACTGTTCTCATGG - Intergenic
1068001653 10:51341939-51341961 GTTTCCCCATACTGTCCTCATGG - Intronic
1068598260 10:58927542-58927564 GTTCCCCCATACTGTTCTCATGG - Intergenic
1073817707 10:107225439-107225461 TTTCCCCCATAATGTCCTCAGGG - Intergenic
1075543029 10:123331314-123331336 GATCCCCCATAGTGTCCTCCAGG + Intergenic
1076994787 11:292593-292615 GGACTCCGTAAATGTCCTCAGGG - Exonic
1078079195 11:8191856-8191878 GTTCCCCCATACTGTTCTCATGG + Intergenic
1084790159 11:71470173-71470195 GTTCCCCCATACTGTTCTCATGG - Intronic
1097189452 12:57212522-57212544 GGTCCCCTATCTCGTCCTCAGGG - Exonic
1098946185 12:76592229-76592251 GTTCCCCCATACTGTTCTCATGG + Intergenic
1100924163 12:99524810-99524832 GTTCCCCAATACTGTTCTCATGG - Intronic
1101816796 12:108151728-108151750 GGTCCCAGAGAGTGGCCTCAAGG - Intronic
1103485239 12:121278556-121278578 GTTCCCCCATACTGTTCTCATGG + Intronic
1104366992 12:128187036-128187058 GTTCCCCCATACTGTTCTCATGG + Intergenic
1109655596 13:65386984-65387006 TTTCCCCCATACTGTCCTCATGG + Intergenic
1110692343 13:78445384-78445406 TTTCCCCCATACTGTCCTCATGG - Intergenic
1111685940 13:91500863-91500885 GTTCCCCCATACTGTTCTCATGG + Intronic
1114938111 14:27570568-27570590 TGTCCCCCATACTGTTCTCATGG - Intergenic
1118739170 14:68726262-68726284 TTTCCCCCATACTGTCCTCATGG - Intronic
1119484965 14:74981148-74981170 GGTCCCCGGGCATGTCCTCATGG - Intergenic
1120477621 14:85008341-85008363 GTTCCCCCATACTGTTCTCATGG + Intergenic
1121710485 14:96035091-96035113 GTTCCCCCATACTGTTCTCATGG + Intergenic
1125279125 15:38025832-38025854 GTTCCCCCATACTGTTCTCAGGG + Intergenic
1125572924 15:40734761-40734783 GGGTCTCAATAATGTCCTCAAGG - Intergenic
1128874855 15:71193654-71193676 GTTCCCCCATACTGTTCTCACGG + Intronic
1128897501 15:71388921-71388943 GTTCCCCCATACTGTTCTCATGG + Intronic
1131659373 15:94497820-94497842 GTTCCCCCATACTGTTCTCATGG + Intergenic
1132533583 16:466362-466384 GGTCCACGATTCTGTCGTCAGGG + Intronic
1134356762 16:13489545-13489567 GTTCCCCCATACTGTTCTCATGG + Intergenic
1134416449 16:14047710-14047732 GTTCCCCCATACTGTTCTCATGG - Intergenic
1134569595 16:15279920-15279942 GTTCCCCCATACTGTTCTCATGG - Intergenic
1134732784 16:16476129-16476151 GTTCCCCCATACTGTTCTCATGG + Intergenic
1134852172 16:17488744-17488766 TGTCCCCCATACTGTTCTCATGG - Intergenic
1134934658 16:18235842-18235864 GTTCCCCCATACTGTTCTCATGG - Intergenic
1141822084 16:86453387-86453409 GTTCCCCCATACTGTTCTCATGG + Intergenic
1144483479 17:15646177-15646199 AGTCCCCGATTATGTACTTAAGG - Intronic
1144915207 17:18718850-18718872 AGTCCCCGATTATGTACTTAAGG + Intronic
1146988956 17:37249897-37249919 GTTCCCCCATACTGTTCTCATGG + Intronic
1149128131 17:53260410-53260432 GTTCCCCCATACTGTTCTCATGG + Intergenic
1150449630 17:65256071-65256093 GTTCCCCCATACTGTTCTCATGG + Intergenic
1150941725 17:69700235-69700257 TTTCCCCCATAGTGTCCTCATGG + Intergenic
1151152263 17:72098288-72098310 GTTCCCCTATACTGTTCTCATGG - Intergenic
1152329953 17:79666979-79667001 GTTCCCCCATACTGTTCTCATGG - Intergenic
1152741343 17:82019807-82019829 GGTCCCCGTGTCTGTCCTCAGGG - Intronic
1152993423 18:383988-384010 TTTCCCCGATACTGTTCTCATGG - Intronic
1153292659 18:3516775-3516797 GTTCCCCTATACTGTTCTCATGG - Intronic
1153337256 18:3937444-3937466 GTTCCCCCATACTGTTCTCATGG - Intronic
1155909324 18:31489935-31489957 TGTCCCCCATACTGTTCTCATGG - Intergenic
1156374959 18:36505099-36505121 GGTTCCCCACAATGTCCACATGG + Intronic
1157368124 18:47085184-47085206 AGTCCCCAGCAATGTCCTCATGG + Intronic
1159981434 18:74786037-74786059 GTTCCCCAATAATTTCCTCAGGG - Intronic
1160119645 18:76118549-76118571 GTTCCCCCATACTGTTCTCATGG - Intergenic
1160292108 18:77604254-77604276 GTTCCCCCATACTGTTCTCATGG - Intergenic
1160436519 18:78856420-78856442 GGTCCCCGAAAACTTCCTCTGGG - Intergenic
1167802739 19:51755652-51755674 TTTCCCCCATAATGTTCTCATGG + Intronic
925402515 2:3585737-3585759 GGCTGCCGTTAATGTCCTCATGG + Intergenic
925849222 2:8064800-8064822 GTTCCCCTATACTGTTCTCATGG - Intergenic
930585468 2:53262853-53262875 GTTCCCCCATACTGTTCTCATGG - Intergenic
932696240 2:73959262-73959284 GGTCCCCCATGCTGTTCTCATGG - Intergenic
934698929 2:96423148-96423170 GTTCCCCCATACTGTCCTCATGG - Intergenic
935671178 2:105558461-105558483 GTTCCCCCATATTGTTCTCATGG - Intergenic
936586589 2:113763665-113763687 GTTCCCCCATACTGTTCTCATGG - Intergenic
937909706 2:127069454-127069476 GGTCCCCGGTAACGTGCACATGG - Intronic
938992332 2:136642261-136642283 GTTCCCCCATACTGTTCTCATGG - Intergenic
942204341 2:173604556-173604578 TTTCCCCCATACTGTCCTCATGG - Intergenic
943913331 2:193595630-193595652 TTTCCCCCATAATGTTCTCATGG - Intergenic
944662774 2:201935064-201935086 TTTCCCCCATAATGTTCTCATGG - Intergenic
946466111 2:219913639-219913661 GTTCCCCCATACTGTTCTCATGG - Intergenic
946879542 2:224163254-224163276 GTTCCCCCATACTGTTCTCATGG + Intergenic
947054569 2:226085721-226085743 GTTCCCCCATACTGTTCTCATGG - Intergenic
1169844506 20:9974944-9974966 GGTCCCCCATACTGTTCTCACGG + Intergenic
1171773863 20:29348066-29348088 GGTTCCCCATACTGTCCTCCTGG - Intergenic
1172569629 20:35959565-35959587 GTTCCCCCATACTGTTCTCATGG - Intronic
1173533577 20:43790445-43790467 GGTCCCAGAACATTTCCTCATGG + Intergenic
1174050129 20:47761911-47761933 GTTCCCCCATACTGTTCTCATGG + Intronic
1174709161 20:52686783-52686805 GTTCCCCCATACTGTTCTCATGG - Intergenic
1177350374 21:19931806-19931828 GGTGCCAGGTAGTGTCCTCAGGG - Intergenic
1177387700 21:20429083-20429105 GGTCCCCCATACTGTTCTCATGG - Intergenic
1177948707 21:27506248-27506270 GTTCCCCCATACTGTTCTCATGG - Intergenic
1178099454 21:29252364-29252386 GTTCCCCCATACTGTTCTCATGG - Intronic
1179316604 21:40249313-40249335 TTTCCCCGATACTGTTCTCATGG + Intronic
1182311672 22:29412970-29412992 GGACCTGGATATTGTCCTCATGG + Intronic
1182377118 22:29856817-29856839 GTTCACCAATCATGTCCTCAGGG + Intergenic
1182688664 22:32140865-32140887 GGACCTGGATATTGTCCTCATGG - Intergenic
1183006489 22:34907069-34907091 GTTCCCCCATACTGTTCTCATGG + Intergenic
1183444983 22:37847678-37847700 GGTCCCCAACAATGTCCTCATGG - Intronic
1185014677 22:48335969-48335991 GGGCCCCTGTAATGACCTCATGG + Intergenic
1185090206 22:48762804-48762826 ACTCCCCGATATTGTTCTCAAGG - Intronic
949403376 3:3688729-3688751 GTTCCCCCATACTGTTCTCATGG + Intergenic
949745918 3:7291904-7291926 GTTCCCCCATACTGTTCTCATGG + Intronic
950178902 3:10897101-10897123 GTTCCCCCATACTGTTCTCATGG - Intronic
951286930 3:20824584-20824606 AGTCACAGATAATTTCCTCAGGG + Intergenic
951306583 3:21070562-21070584 GTTCCCCAATACTGTTCTCATGG - Intergenic
956318321 3:67965317-67965339 TGTCCCCCATACTGTTCTCATGG - Intergenic
956546236 3:70407107-70407129 GTTCCCCCATACTGTTCTCATGG - Intergenic
958419336 3:93913337-93913359 TTTCCCCGATACTGTGCTCATGG + Intronic
958660680 3:97062637-97062659 GTTCCCCCATACTGTTCTCATGG + Intronic
959202803 3:103270730-103270752 GTTCCCCCATACTGTTCTCATGG - Intergenic
960153160 3:114271614-114271636 GTTCCCCCATACAGTCCTCATGG + Intergenic
960263996 3:115599340-115599362 CGTCCCCGATACTGTTCTCATGG - Intergenic
960443436 3:117717848-117717870 GGTTCCCCATACTGTTCTCATGG + Intergenic
967501455 3:190202946-190202968 GTTCCCCCATACTGTTCTCATGG + Intergenic
968749931 4:2383281-2383303 GTTCCCCCATACTGTTCTCATGG + Intronic
970222381 4:13824318-13824340 GTTCCCCCATACTGTTCTCATGG + Intergenic
971134644 4:23855033-23855055 ACTCCCCGATACTGTTCTCATGG + Intronic
973698548 4:53514548-53514570 GTTCCCCCATACTGTTCTCATGG - Intronic
974445567 4:61976623-61976645 GTTCCCCCATACTGTTCTCATGG + Intronic
974487693 4:62525789-62525811 GTTTCCCCATACTGTCCTCATGG + Intergenic
975507144 4:75149878-75149900 GGTCCCTCATACTGTTCTCATGG - Intergenic
976461325 4:85315646-85315668 GTTCCCCCATAATGTTCTCATGG - Intergenic
979218669 4:118195338-118195360 GTTCCCCCATACTGTTCTCATGG + Intronic
979294030 4:119010449-119010471 GTTCCCCCATATTGTTCTCATGG - Intronic
979547637 4:121955461-121955483 GATCCCCCATACTGTTCTCATGG - Intergenic
981811515 4:148780864-148780886 GTTCCCCCATACTGTTCTCATGG - Intergenic
981820504 4:148881358-148881380 TTTCCCCCATAATGTCCTCATGG - Intergenic
981863036 4:149379932-149379954 GTTCCCCCATACTGTTCTCATGG + Intergenic
982424843 4:155246746-155246768 GATCCCCCATACTGTTCTCATGG - Intergenic
986137704 5:4998461-4998483 GTTCCCCCATATTGTTCTCATGG - Intergenic
986285166 5:6353857-6353879 GGCCCCTGAAAAGGTCCTCAGGG + Intergenic
986397096 5:7342064-7342086 TTTCCCCCATACTGTCCTCATGG + Intergenic
986626879 5:9730808-9730830 GTTCCCCCATACTGTCATCATGG + Intergenic
987870963 5:23616007-23616029 GATTCCTGAAAATGTCCTCATGG + Intergenic
988185277 5:27853107-27853129 TTTCCCCCATACTGTCCTCATGG + Intergenic
988834451 5:35017447-35017469 GTTCCCCCATACTGTTCTCATGG + Intronic
988865610 5:35331188-35331210 GTTCCCCCATACTGTTCTCATGG + Intergenic
989516460 5:42348994-42349016 GTTCCCCCATATTGTTCTCATGG + Intergenic
992611707 5:78513662-78513684 GATCCCCCATACTGTTCTCATGG + Intronic
993504286 5:88692263-88692285 GGTACCCGAATCTGTCCTCAAGG + Intergenic
994478974 5:100309015-100309037 GTTCCCCGATACTGTTCTCATGG - Intergenic
995597870 5:113766729-113766751 GTTCCCCCATACTGTTCTCATGG + Intergenic
996834459 5:127775773-127775795 GTTCCCCCATACTGTCCTTATGG + Intergenic
996871529 5:128198509-128198531 GTTCCCCCATACTGTTCTCATGG + Intergenic
997642241 5:135456810-135456832 TGTCCCCCATCATGTGCTCAGGG + Intergenic
1000707489 5:164529408-164529430 GGTCCCTCATAAGGTCCACATGG - Intergenic
1001613298 5:173021480-173021502 GTTCCCCCATACTGTTCTCATGG - Intronic
1001646451 5:173285334-173285356 GTTCCCCCATACTGTTCTCATGG + Intergenic
1004237736 6:13889476-13889498 GTTCCCCCATAATGTTCTCATGG + Intergenic
1004834412 6:19515119-19515141 GTTCCCCCATACTGTTCTCATGG + Intergenic
1005627179 6:27673577-27673599 GGTCGCCGATTATCTCCACATGG + Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1008242420 6:49128961-49128983 GTTCCCCCATACTGTTCTCATGG + Intergenic
1014147500 6:118015005-118015027 GTTCCCCCATACTGTTCTCATGG + Intronic
1015856724 6:137632803-137632825 GTTCCCCCATACTGTTCTCATGG - Intergenic
1018031873 6:159847825-159847847 GTTCCCCCATACTGTTCTCATGG + Intergenic
1018784610 6:167098427-167098449 GCTCCCCGATTATGACCTCCGGG - Intergenic
1018873157 6:167798048-167798070 GGTCCCCAACAATGTCCTGAGGG + Intergenic
1020126258 7:5533987-5534009 GGTCCCCTGGAATGTCCCCAAGG + Intronic
1027849204 7:83427771-83427793 GGTCACTGAAAATGTCATCATGG - Intronic
1028402544 7:90439810-90439832 GTTCCCCCATACTGTTCTCATGG - Intronic
1029315456 7:99708793-99708815 GGTCCTCAATTATGTCCTTATGG - Intronic
1034715912 7:153241160-153241182 TTTCCCCCATAATGTTCTCATGG - Intergenic
1036566325 8:9941307-9941329 GTTCCCCCATATTGTTCTCATGG + Intergenic
1037031274 8:14108575-14108597 TTTCCCCCATAATGTTCTCACGG - Intronic
1037037185 8:14181614-14181636 GTTCCCCAATACTGTTCTCATGG + Intronic
1037095424 8:14980696-14980718 TTTCCCCCATAATGTTCTCATGG - Intronic
1037315853 8:17598788-17598810 GTTCCCCCATACTGTTCTCATGG + Intronic
1037436570 8:18869863-18869885 GCTCACGGATACTGTCCTCATGG - Intronic
1039320270 8:36422344-36422366 GTTCCCCCATACTGTTCTCATGG + Intergenic
1041718483 8:60953457-60953479 GTTCCCCCATACTGTTCTCATGG + Intergenic
1042481177 8:69304673-69304695 GTTCCCCCATACTGTTCTCATGG - Intergenic
1043088067 8:75861911-75861933 GTTCCCCCATACTGTTCTCATGG + Intergenic
1043213821 8:77559893-77559915 GTTCCCCCATACTGTTCTCATGG - Intergenic
1047367339 8:124223478-124223500 GGTCACAGAGAATGTCCTCCTGG - Intergenic
1049113477 8:140664962-140664984 AGTGGCCAATAATGTCCTCAGGG + Exonic
1049442505 8:142615729-142615751 TGTCAGCGATGATGTCCTCATGG - Intergenic
1050849445 9:10264887-10264909 GTTCCCCCATACTGTTCTCATGG + Intronic
1055174903 9:73305727-73305749 GTTCCCCCATACTGTTCTCATGG + Intergenic
1057886113 9:98830948-98830970 CGTCCCCCAAAATGTACTCAAGG + Intronic
1058134250 9:101289580-101289602 GTTCCCCCATACTGTTCTCATGG + Intronic
1060312099 9:122471248-122471270 GTTCCCCCATACTGTTCTCATGG + Intergenic
1062282705 9:135759135-135759157 GGTCCCAGATGCTATCCTCATGG - Intronic
1062552566 9:137096580-137096602 GGTCCCCGATAATGTCCTCATGG + Intronic
1186140719 X:6569703-6569725 AGTCCCCGATTATGTCCACTTGG + Intergenic
1188449714 X:30295885-30295907 GTTCCCCCATATTGTTCTCATGG + Intergenic
1189674464 X:43446871-43446893 GTTCCCCCATACTGTTCTCATGG + Intergenic
1191923055 X:66278231-66278253 GTTCCCCCATAATGTTCTCATGG - Intergenic
1194549896 X:95284636-95284658 GTTCCCCCATACTGTTCTCATGG - Intergenic
1195313379 X:103655400-103655422 GTTCCCCCATACTGTTCTCATGG - Intergenic
1198707084 X:139461247-139461269 GTTCCCCCATACTGTTCTCATGG + Intergenic