ID: 1062552593

View in Genome Browser
Species Human (GRCh38)
Location 9:137096714-137096736
Sequence CTGCTCGACCAGATGGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062552593_1062552601 4 Left 1062552593 9:137096714-137096736 CCGAGCCCCATCTGGTCGAGCAG 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1062552601 9:137096741-137096763 CAGAGGGAGAGGGAGTTGCCCGG No data
1062552593_1062552600 -6 Left 1062552593 9:137096714-137096736 CCGAGCCCCATCTGGTCGAGCAG 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1062552600 9:137096731-137096753 GAGCAGAGAGCAGAGGGAGAGGG No data
1062552593_1062552602 12 Left 1062552593 9:137096714-137096736 CCGAGCCCCATCTGGTCGAGCAG 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1062552602 9:137096749-137096771 GAGGGAGTTGCCCGGTGCCCAGG No data
1062552593_1062552599 -7 Left 1062552593 9:137096714-137096736 CCGAGCCCCATCTGGTCGAGCAG 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1062552599 9:137096730-137096752 CGAGCAGAGAGCAGAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062552593 Original CRISPR CTGCTCGACCAGATGGGGCT CGG (reversed) Intronic
900173638 1:1282352-1282374 CTGCTGGACCCTGTGGGGCTGGG + Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
901930771 1:12595334-12595356 CTGCCCGACCCGCTGAGGCTTGG - Intronic
902632166 1:17711424-17711446 CTGCTCGACAAGATGGCGTCTGG - Intergenic
906458921 1:46022569-46022591 CTGCTTCACTGGATGGGGCTGGG - Intronic
907740476 1:57160864-57160886 CTGGTTGATTAGATGGGGCTGGG + Intronic
913130494 1:115834286-115834308 CCGCTGGGCCAGCTGGGGCTAGG + Intergenic
915497534 1:156292523-156292545 CTGCTCCACCAGGTAGAGCTGGG - Intronic
920093425 1:203470456-203470478 CTGCTCGGCCAGAAGGGGCCTGG + Intergenic
922663281 1:227448296-227448318 CTGCTGGACCTGGCGGGGCTGGG - Intergenic
1063095441 10:2904687-2904709 CTGGTCTACCAGAGGGAGCTCGG - Intergenic
1067337192 10:45375057-45375079 CTGAGCCACCAGATGGGCCTGGG - Intronic
1067708311 10:48627539-48627561 CTGCTAGCCCAGATGGGAATGGG - Intronic
1067940500 10:50650992-50651014 CTTCTCTACCAGATGGTGTTTGG - Intergenic
1068538449 10:58267247-58267269 CCACTCGAGCAGAAGGGGCTCGG - Intronic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1074647571 10:115477592-115477614 CTGCTCGAAGATATGGGACTTGG + Intronic
1075302616 10:121338837-121338859 CTGCTAAGCCAGATGGGGCCTGG + Intergenic
1079690027 11:23406332-23406354 CTGCTGGACCAGGTGGGCATAGG - Intergenic
1080645091 11:34182384-34182406 CTGCTGGAGGAGATGAGGCTGGG - Intronic
1082802876 11:57427167-57427189 CTGCCCGCCCGGAAGGGGCTGGG + Intronic
1084400432 11:68939942-68939964 GTGCTCGTGCAGGTGGGGCTTGG + Exonic
1093547992 12:20369798-20369820 GCGCTCGTCCAGATTGGGCTGGG + Exonic
1096804594 12:54132925-54132947 CTTGTCAACCAGCTGGGGCTGGG - Intergenic
1100329280 12:93570176-93570198 CTGCGCGCCCGGAAGGGGCTTGG - Intronic
1100346969 12:93742143-93742165 CTGCTCTGCCAGATGCTGCTCGG - Intronic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1110832135 13:80043780-80043802 CTACTAGACCAGATGGGGCCAGG + Intergenic
1118314348 14:64716629-64716651 CTGCTCTACCAGCTGACGCTTGG - Intronic
1122613729 14:103002658-103002680 CTGCTCGCCAGGCTGGGGCTGGG + Intronic
1122806685 14:104263352-104263374 CTGCTGCACCAGACAGGGCTGGG + Intergenic
1123161869 14:106286744-106286766 GTGCGAGACCAGATGGCGCTAGG - Intergenic
1123177588 14:106436342-106436364 GTGCGAGACCAGATGGCGCTAGG - Intergenic
1123179899 14:106460006-106460028 GTGCGAGACCAGATGGCGCTAGG - Intergenic
1124577925 15:30925968-30925990 CTGCTCGTCCACCCGGGGCTGGG - Intronic
1135421792 16:22309713-22309735 CTGCCTGACCAGATGGGGTGGGG + Intronic
1136275390 16:29176759-29176781 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1136536787 16:30904233-30904255 CTCATCTAGCAGATGGGGCTTGG - Intergenic
1136599305 16:31273852-31273874 CTGCTGGACCAGATGGCCTTGGG + Intronic
1138536002 16:57660627-57660649 CTTCCCCACCAGATGGGGCTGGG + Intronic
1139309227 16:66014329-66014351 CTGCACTTCAAGATGGGGCTTGG - Intergenic
1139511922 16:67432467-67432489 CTGTGTGATCAGATGGGGCTGGG + Intronic
1141440706 16:84027841-84027863 CTGCTGCACCATATGGCGCTTGG + Intronic
1142079750 16:88142824-88142846 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1142211783 16:88811867-88811889 CTGCTCAACCAGCTGCAGCTCGG + Exonic
1144670734 17:17131291-17131313 CTGCTCTCCCAGAGTGGGCTTGG - Intronic
1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG + Intergenic
1149494689 17:57109754-57109776 CTGCTCCAGCAGCTGTGGCTGGG + Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1154162500 18:11990574-11990596 CTGCTCGAACTGATGGGGTGTGG + Intronic
1157409163 18:47449271-47449293 CTGCTGAGCCAGATGGGGTTGGG + Intergenic
1162494000 19:11013003-11013025 CTGGCCGACGAGATGGGCCTGGG + Exonic
1163152343 19:15422828-15422850 CTGCTGGACCAGGTGGGCATGGG + Exonic
1166885884 19:45960819-45960841 CTGGCCGAGCAGATGGGGGTGGG - Intronic
1167055769 19:47111250-47111272 CTGCTCGAGCAGAAGGAGTTGGG - Intronic
926197531 2:10772842-10772864 CTGCTCGGCCAGGTGGGGCCAGG - Intronic
932435211 2:71699330-71699352 CTCCTCCCCCAGCTGGGGCTGGG + Intergenic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
938069175 2:128299555-128299577 CTCATCCACCACATGGGGCTGGG - Intronic
938407553 2:131040850-131040872 CTTCTCTACCAGGTGAGGCTAGG - Intronic
946307733 2:218865720-218865742 CTGCTCGCCCATATTGGGGTGGG - Intronic
948091666 2:235301071-235301093 GTGCTCCTCTAGATGGGGCTAGG + Intergenic
1173576835 20:44117501-44117523 CTGCTGTACCAGATAGCGCTGGG - Intronic
1175888960 20:62307656-62307678 CTGCTGGAGCAGAAGGGGCTGGG - Exonic
1181036013 22:20169975-20169997 CTGGTCCACCAGATGAGGCGTGG - Intergenic
1183618876 22:38961314-38961336 CGCCTGGACCAGGTGGGGCTGGG - Intronic
1183624079 22:38991259-38991281 CGCCTGGACCAGGTGGGGCTGGG - Intronic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
1185100828 22:48840101-48840123 CAGCTCCAGCAGATGGGCCTCGG + Intronic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
953726837 3:45406974-45406996 CTTCTGGACCAGAAGGTGCTGGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
957002526 3:74902693-74902715 CTGCTAGACCAGATGGGTCTGGG + Intergenic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
969459627 4:7322140-7322162 CTGCTTGACCAGAGGGGGCCGGG + Intronic
985856325 5:2430108-2430130 CAGCCTGACCAGCTGGGGCTGGG - Intergenic
999006230 5:147982482-147982504 CTCCTTGACCCAATGGGGCTAGG - Intergenic
1005520738 6:26598431-26598453 CTGCTCGCCCAGATGGCTCCTGG + Exonic
1007172834 6:39876667-39876689 CTCCTCCACCAGCTGGGGCCAGG + Intronic
1007719719 6:43877949-43877971 CTGTTCCACCAGATGCTGCTGGG + Intergenic
1016992534 6:149940097-149940119 CTGCCTGACCAGGTGGGGGTTGG - Intergenic
1016995088 6:149956039-149956061 CTGCCTGACCAGGTGGGGGTTGG - Intergenic
1016999379 6:149985493-149985515 CTGCCTGACCAGGTGGGGGTTGG - Intergenic
1017003524 6:150013396-150013418 CTGCCTGACCAGGTGGGGGTTGG + Intergenic
1017007200 6:150036524-150036546 CTGCCTGACCAGGTGGGGGTTGG + Intergenic
1017159139 6:151349153-151349175 CTGCTTGGCCAGATTCGGCTGGG - Exonic
1018632631 6:165834187-165834209 CTCCTCAACCAGTTGGGGCCAGG + Intronic
1019428301 7:987520-987542 CTGCTCCCCAAGGTGGGGCTGGG + Exonic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019868662 7:3737430-3737452 CTGCTCTGCTAGGTGGGGCTTGG + Intronic
1020680319 7:11228720-11228742 CTGCTTGTCCAGATAGGGTTGGG + Intergenic
1023351921 7:39328825-39328847 CAGCTGGACCAGATAGGGCATGG + Intronic
1026827078 7:73591163-73591185 CTGATCCTTCAGATGGGGCTGGG - Intergenic
1031195655 7:118609874-118609896 CTGCTCCACCAGGATGGGCTGGG - Intergenic
1033755301 7:144394099-144394121 CTGCTAGCCCTCATGGGGCTCGG - Intergenic
1034463287 7:151210378-151210400 CTGCCCCACCAGGTGTGGCTGGG + Intronic
1035580946 8:738660-738682 CTGCGCGCCCAGGTGGGGCTGGG + Intergenic
1037408091 8:18565148-18565170 CTGAACGACCTGGTGGGGCTGGG + Intronic
1041031121 8:53736223-53736245 CTGCTGGGCCAGACGGGTCTGGG - Intronic
1043612300 8:82080052-82080074 CTGCTCCACAAGATGGGGCTGGG + Intergenic
1046671849 8:117064786-117064808 CTCCTCTCCCAGATGGGGCTGGG - Intronic
1047433071 8:124809389-124809411 CTGCTAGGCCAGAGGGGACTGGG - Intergenic
1050923584 9:11235455-11235477 CTGCTCTGTCAGATGGGGCTAGG + Intergenic
1056740622 9:89251318-89251340 CAGCTCTGCCAGATGGTGCTGGG - Intergenic
1059432224 9:114257169-114257191 CTGAGGCACCAGATGGGGCTGGG + Intronic
1060821194 9:126662505-126662527 CTGCTCTCCCAGACTGGGCTGGG - Intronic
1061411783 9:130425820-130425842 GTGCTGCACCAGCTGGGGCTGGG - Exonic
1062337982 9:136080903-136080925 CTACTCGAGCGGCTGGGGCTTGG - Intronic
1062552593 9:137096714-137096736 CTGCTCGACCAGATGGGGCTCGG - Intronic
1192759775 X:74085378-74085400 CTGCTCAGCCAGAATGGGCTAGG + Intergenic
1197206839 X:123798213-123798235 CTACTGGACCTGATGGGGATGGG + Intergenic
1197209300 X:123815998-123816020 CTACTGGACCTGATGGGGATGGG - Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic
1201277380 Y:12312198-12312220 CTGGTGGCCCAGATGGGGGTTGG + Intergenic
1201359315 Y:13129035-13129057 CTGCAAGAAGAGATGGGGCTTGG + Intergenic