ID: 1062555516

View in Genome Browser
Species Human (GRCh38)
Location 9:137112014-137112036
Sequence TGATCTCGGTGCAGGCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062555510_1062555516 19 Left 1062555510 9:137111972-137111994 CCGGGAACATATCGGTCACATTG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1062555516 9:137112014-137112036 TGATCTCGGTGCAGGCCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062555516 Original CRISPR TGATCTCGGTGCAGGCCTGC AGG Exonic