ID: 1062555516 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:137112014-137112036 |
Sequence | TGATCTCGGTGCAGGCCTGC AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 121 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 110} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1062555510_1062555516 | 19 | Left | 1062555510 | 9:137111972-137111994 | CCGGGAACATATCGGTCACATTG | 0: 1 1: 0 2: 0 3: 5 4: 82 |
||
Right | 1062555516 | 9:137112014-137112036 | TGATCTCGGTGCAGGCCTGCAGG | 0: 1 1: 0 2: 0 3: 10 4: 110 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1062555516 | Original CRISPR | TGATCTCGGTGCAGGCCTGC AGG | Exonic | ||