ID: 1062557798

View in Genome Browser
Species Human (GRCh38)
Location 9:137123496-137123518
Sequence CTGTGTTTTTGGGGGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062557786_1062557798 29 Left 1062557786 9:137123444-137123466 CCTACGTTTCTGTCAGGACAAGA No data
Right 1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG No data
1062557785_1062557798 30 Left 1062557785 9:137123443-137123465 CCCTACGTTTCTGTCAGGACAAG No data
Right 1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062557798 Original CRISPR CTGTGTTTTTGGGGGTCAGA TGG Intergenic
No off target data available for this crispr