ID: 1062558969

View in Genome Browser
Species Human (GRCh38)
Location 9:137130593-137130615
Sequence AGCAGAATCGCCCAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062558969_1062558979 10 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558979 9:137130626-137130648 GTCCTGGCTGTGGCATTTCTGGG No data
1062558969_1062558981 17 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558981 9:137130633-137130655 CTGTGGCATTTCTGGGTGTTTGG No data
1062558969_1062558983 21 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558983 9:137130637-137130659 GGCATTTCTGGGTGTTTGGAGGG No data
1062558969_1062558978 9 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558978 9:137130625-137130647 GGTCCTGGCTGTGGCATTTCTGG No data
1062558969_1062558975 0 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558975 9:137130616-137130638 GCGTCCCACGGTCCTGGCTGTGG No data
1062558969_1062558982 20 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558982 9:137130636-137130658 TGGCATTTCTGGGTGTTTGGAGG No data
1062558969_1062558984 30 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558969_1062558974 -6 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558974 9:137130610-137130632 TCTGCTGCGTCCCACGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062558969 Original CRISPR AGCAGAATCGCCCAAGGGGC AGG (reversed) Intergenic