ID: 1062558976

View in Genome Browser
Species Human (GRCh38)
Location 9:137130620-137130642
Sequence AATGCCACAGCCAGGACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062558976_1062558983 -6 Left 1062558976 9:137130620-137130642 CCCACGGTCCTGGCTGTGGCATT No data
Right 1062558983 9:137130637-137130659 GGCATTTCTGGGTGTTTGGAGGG No data
1062558976_1062558982 -7 Left 1062558976 9:137130620-137130642 CCCACGGTCCTGGCTGTGGCATT No data
Right 1062558982 9:137130636-137130658 TGGCATTTCTGGGTGTTTGGAGG No data
1062558976_1062558981 -10 Left 1062558976 9:137130620-137130642 CCCACGGTCCTGGCTGTGGCATT No data
Right 1062558981 9:137130633-137130655 CTGTGGCATTTCTGGGTGTTTGG No data
1062558976_1062558984 3 Left 1062558976 9:137130620-137130642 CCCACGGTCCTGGCTGTGGCATT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062558976 Original CRISPR AATGCCACAGCCAGGACCGT GGG (reversed) Intergenic