ID: 1062558977

View in Genome Browser
Species Human (GRCh38)
Location 9:137130621-137130643
Sequence AAATGCCACAGCCAGGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062558977_1062558983 -7 Left 1062558977 9:137130621-137130643 CCACGGTCCTGGCTGTGGCATTT No data
Right 1062558983 9:137130637-137130659 GGCATTTCTGGGTGTTTGGAGGG No data
1062558977_1062558989 30 Left 1062558977 9:137130621-137130643 CCACGGTCCTGGCTGTGGCATTT No data
Right 1062558989 9:137130674-137130696 ACGTCTAATGTCTATAATCCCGG No data
1062558977_1062558982 -8 Left 1062558977 9:137130621-137130643 CCACGGTCCTGGCTGTGGCATTT No data
Right 1062558982 9:137130636-137130658 TGGCATTTCTGGGTGTTTGGAGG No data
1062558977_1062558984 2 Left 1062558977 9:137130621-137130643 CCACGGTCCTGGCTGTGGCATTT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062558977 Original CRISPR AAATGCCACAGCCAGGACCG TGG (reversed) Intergenic