ID: 1062558980

View in Genome Browser
Species Human (GRCh38)
Location 9:137130628-137130650
Sequence CACCCAGAAATGCCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062558980_1062558984 -5 Left 1062558980 9:137130628-137130650 CCTGGCTGTGGCATTTCTGGGTG No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558980_1062558989 23 Left 1062558980 9:137130628-137130650 CCTGGCTGTGGCATTTCTGGGTG No data
Right 1062558989 9:137130674-137130696 ACGTCTAATGTCTATAATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062558980 Original CRISPR CACCCAGAAATGCCACAGCC AGG (reversed) Intergenic