ID: 1062558984

View in Genome Browser
Species Human (GRCh38)
Location 9:137130646-137130668
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062558970_1062558984 26 Left 1062558970 9:137130597-137130619 CCCCTTGGGCGATTCTGCTGCGT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558972_1062558984 24 Left 1062558972 9:137130599-137130621 CCTTGGGCGATTCTGCTGCGTCC No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558977_1062558984 2 Left 1062558977 9:137130621-137130643 CCACGGTCCTGGCTGTGGCATTT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558980_1062558984 -5 Left 1062558980 9:137130628-137130650 CCTGGCTGTGGCATTTCTGGGTG No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558976_1062558984 3 Left 1062558976 9:137130620-137130642 CCCACGGTCCTGGCTGTGGCATT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558969_1062558984 30 Left 1062558969 9:137130593-137130615 CCTGCCCCTTGGGCGATTCTGCT No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data
1062558971_1062558984 25 Left 1062558971 9:137130598-137130620 CCCTTGGGCGATTCTGCTGCGTC No data
Right 1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062558984 Original CRISPR GGGTGTTTGGAGGGCTCCCC CGG Intergenic
No off target data available for this crispr