ID: 1062560470

View in Genome Browser
Species Human (GRCh38)
Location 9:137139385-137139407
Sequence CCGCGGGGCCGGGCGAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 427}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062560457_1062560470 16 Left 1062560457 9:137139346-137139368 CCGGGACCGCCGCTCCGGGGGAG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560461_1062560470 2 Left 1062560461 9:137139360-137139382 CCGGGGGAGACGTGGCGTCCGCA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560458_1062560470 10 Left 1062560458 9:137139352-137139374 CCGCCGCTCCGGGGGAGACGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560451_1062560470 24 Left 1062560451 9:137139338-137139360 CCGACGTCCCGGGACCGCCGCTC 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560450_1062560470 30 Left 1062560450 9:137139332-137139354 CCTCGGCCGACGTCCCGGGACCG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560460_1062560470 7 Left 1062560460 9:137139355-137139377 CCGCTCCGGGGGAGACGTGGCGT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560456_1062560470 17 Left 1062560456 9:137139345-137139367 CCCGGGACCGCCGCTCCGGGGGA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062560470 Original CRISPR CCGCGGGGCCGGGCGAGCGC AGG Intronic