ID: 1062560470

View in Genome Browser
Species Human (GRCh38)
Location 9:137139385-137139407
Sequence CCGCGGGGCCGGGCGAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 427}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062560458_1062560470 10 Left 1062560458 9:137139352-137139374 CCGCCGCTCCGGGGGAGACGTGG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560456_1062560470 17 Left 1062560456 9:137139345-137139367 CCCGGGACCGCCGCTCCGGGGGA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560450_1062560470 30 Left 1062560450 9:137139332-137139354 CCTCGGCCGACGTCCCGGGACCG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560457_1062560470 16 Left 1062560457 9:137139346-137139368 CCGGGACCGCCGCTCCGGGGGAG 0: 1
1: 0
2: 0
3: 14
4: 98
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560460_1062560470 7 Left 1062560460 9:137139355-137139377 CCGCTCCGGGGGAGACGTGGCGT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560451_1062560470 24 Left 1062560451 9:137139338-137139360 CCGACGTCCCGGGACCGCCGCTC 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427
1062560461_1062560470 2 Left 1062560461 9:137139360-137139382 CCGGGGGAGACGTGGCGTCCGCA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG 0: 1
1: 0
2: 2
3: 60
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062560470 Original CRISPR CCGCGGGGCCGGGCGAGCGC AGG Intronic
900371852 1:2335759-2335781 GTGCGGGGCCAGGCGAGGGCTGG + Intronic
900513199 1:3069864-3069886 CCGCGGAGCCGGGTGGGCGCCGG - Intronic
900658838 1:3772921-3772943 CCGCGGTGCGGGGCCAGGGCCGG + Intronic
900787102 1:4655818-4655840 CCGCTGGGCGCGGCGGGCGCGGG + Intronic
901007633 1:6179651-6179673 CCGCGGGCCGGGGCCTGCGCTGG - Intronic
901088420 1:6625737-6625759 GGGCCGGGCCGGGCGAGTGCTGG - Intronic
901109767 1:6785423-6785445 CCGCGGGGCGGGGCCAGGGCGGG + Exonic
901332768 1:8423730-8423752 GCGCGGGGCCCGGGGGGCGCGGG + Intronic
901628955 1:10638965-10638987 GCGCGGGGCCGGGGGCGCCCAGG + Exonic
901641119 1:10693763-10693785 CGGCGGGGCCGGGTGGGGGCCGG - Intronic
902214305 1:14924627-14924649 CGCCGGGGCCGGGCGCGCGAGGG + Intronic
902304655 1:15526859-15526881 CCCCAGGCCCAGGCGAGCGCTGG + Exonic
902600883 1:17539668-17539690 CCCCGGGACCGGGCGGGCGGGGG + Intergenic
903069074 1:20717776-20717798 CCAAGGGGCGGGGCCAGCGCCGG + Exonic
903078132 1:20787385-20787407 GCGCGGGGACGGGCGGACGCCGG + Intergenic
903413829 1:23168285-23168307 GCGCGGGGCCCGGCGGGCACCGG - Intronic
903628214 1:24745943-24745965 CCCCAGCGCCGGGCGCGCGCGGG + Intronic
904467762 1:30718426-30718448 CGGCGGGGCGGGGCCAGAGCAGG - Intronic
904467844 1:30718661-30718683 CGGCGGGGCGGGGCCAGGGCTGG - Intronic
905037752 1:34929174-34929196 CCGCGGGGACAGGCCAGCCCCGG - Intronic
905517177 1:38570279-38570301 CCGCGGGGCAGGCCGGGCGCAGG + Intergenic
905518385 1:38578708-38578730 GGGCGGGGTCGGGCGGGCGCGGG + Intergenic
906214383 1:44030524-44030546 GGGCGGGGCCGGGCGGCCGCAGG - Intronic
906615845 1:47232264-47232286 TGGAGGGGCCGGGCGGGCGCGGG - Intergenic
907160675 1:52366475-52366497 CGGTGGGGCGGGGCGAGGGCTGG - Intergenic
907429839 1:54405675-54405697 CCGTGGCGCGGGTCGAGCGCGGG - Intronic
907767367 1:57424159-57424181 GCGGGGCGCCGGGCGGGCGCGGG - Intronic
908534866 1:65067540-65067562 GCGCGGGGCCGAGCGCCCGCGGG - Intergenic
910759278 1:90718800-90718822 CTGCGGTGTCGGGCGGGCGCGGG + Intergenic
912315089 1:108661091-108661113 CAGCGAGGCCGTGCGTGCGCGGG - Intronic
912433720 1:109643793-109643815 CTGCGGGGCTGGGCCAGCGCGGG + Intergenic
912532744 1:110338471-110338493 CCGCGGGCCCAGGTGACCGCGGG + Intergenic
912798672 1:112707339-112707361 CGGAGGAGCCGGGCGAGCGGGGG + Intronic
915333507 1:155127799-155127821 GCGCCGGGCGGGGCGAGGGCGGG + Exonic
916694423 1:167221415-167221437 GGCCGGGGCCGGGCGGGCGCGGG + Intronic
916792577 1:168136902-168136924 ACGCGGACCCGGGCGGGCGCAGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
918048292 1:180954213-180954235 CCGCGGGGCCTCGCGCGGGCGGG + Intergenic
920184588 1:204152081-204152103 CCGCGGGCCGGGGCGGGGGCGGG - Intergenic
921355454 1:214281075-214281097 CCGCGGGGGCGCGCGAGGCCCGG + Intergenic
921604418 1:217137740-217137762 GCGCGGGGGAGGGCGAGGGCGGG - Intronic
922851320 1:228735848-228735870 CCGGGGGGCCGGGGGCGTGCGGG + Exonic
923107906 1:230868560-230868582 GCGCGGGGCGGGGCGAGGGCGGG - Exonic
923631208 1:235650202-235650224 CCGCGTGGCCGGGGGACCACTGG + Intronic
924090104 1:240492922-240492944 CCCAGCGGCCGGGCGCGCGCGGG + Exonic
1062873869 10:930924-930946 CCCCCAGGCCGGGCGGGCGCCGG - Intronic
1062874189 10:931856-931878 CGGCGGGGCGGGCCGAGCGTCGG - Intergenic
1065099568 10:22320740-22320762 CCGCGGGGCCGGCCGGGGGGCGG + Intronic
1065588507 10:27242103-27242125 CCGCGGGGCAGGGCGAGGGGCGG - Intronic
1066180528 10:32957758-32957780 CCGCCGGGCTGGGCAAGCGCAGG - Exonic
1067342944 10:45419227-45419249 CAGGGAGGCCGGGCGAGCGCAGG + Intronic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067769856 10:49115401-49115423 CGGCGGGGCCAGGCGGGAGCGGG - Intronic
1068335723 10:55630679-55630701 CTGCGGTGCCGGGCGGGCTCAGG + Intergenic
1068955852 10:62818194-62818216 GCGCTGGGCCCGGCGAGAGCTGG - Intronic
1069651668 10:70053605-70053627 CCGGGTGGCGGGGCGAGGGCTGG + Intronic
1069846774 10:71377498-71377520 CCGCGGGGCAGGCCGGGAGCCGG + Intergenic
1071784213 10:88880710-88880732 CCTCGTGGCCTGGCGCGCGCCGG + Intronic
1072619243 10:97068679-97068701 AGGTGGGGCCGGGCGAGTGCGGG - Intronic
1072638927 10:97196363-97196385 CCGCGAGGACGCGCGAGGGCGGG + Intronic
1072784071 10:98268403-98268425 CCGGGGGGCGGGGGGAGCGGGGG + Intergenic
1072926378 10:99620447-99620469 CCGCGGGGCCAAGCGGGAGCCGG - Intronic
1073099295 10:100998540-100998562 CCTGGGGCCCGGGCGAGCTCCGG + Intronic
1073812453 10:107165002-107165024 CCGCGGGGGCGGTCGACCCCGGG + Intergenic
1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG + Intronic
1075802538 10:125161542-125161564 CCGCGGGGTCAGGCGCGGGCCGG + Intergenic
1076734659 10:132453228-132453250 TCGCGGGGCAGGGCGGGCGCTGG + Intergenic
1076793288 10:132787599-132787621 TCTCGGGGCCGGACGGGCGCTGG - Intergenic
1076864530 10:133160356-133160378 GGGCGGGGGCGGGCGAGGGCCGG + Intergenic
1076899418 10:133330006-133330028 CCGCGGGGCTGGGAGAGGGCGGG + Intronic
1076908197 10:133373560-133373582 CGGCGGGGCCTGGAGGGCGCTGG - Exonic
1076993837 11:289093-289115 CCGAGGGCCCGGGCGGTCGCTGG - Intergenic
1076994244 11:290486-290508 CCCCGGGGCCAGGCGGGCGATGG - Exonic
1077020931 11:416898-416920 ACCCGGCGCCGGGCGAGCTCGGG + Intronic
1077043768 11:535574-535596 GCGCGGGGCGGGGCGTGCGCAGG - Intronic
1077076908 11:706158-706180 CGGCGGGGCCGGGCCGGGGCGGG - Exonic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077544885 11:3165010-3165032 CCGCGGGGCCGGTCGCGCGCTGG - Intronic
1077922998 11:6655533-6655555 CAGACGGGCCGGGCGGGCGCGGG + Intronic
1078090718 11:8263029-8263051 CCGCGGGGCCGCGCGGAGGCTGG - Intronic
1083430658 11:62612425-62612447 CCGCGGGGCCCGGTGAGTACGGG - Exonic
1083571263 11:63763340-63763362 CCGAAGGGCCGGGCGAGCACAGG + Exonic
1083822630 11:65181684-65181706 CCCCGGGGAGGGGCCAGCGCGGG - Exonic
1084129140 11:67119621-67119643 CCGGGGGGCCGGGGCGGCGCGGG + Intronic
1084357464 11:68649835-68649857 CCCCGGGGCCGGGAAAGGGCCGG + Intergenic
1084385810 11:68841989-68842011 CGGCGGGGCGGGGCGTCCGCGGG + Intronic
1084636906 11:70398783-70398805 GGGCGGGGCAGGGCGAGGGCCGG + Intronic
1084972993 11:72781595-72781617 CAGCGACGCCGGGCGGGCGCGGG + Intronic
1085396528 11:76209575-76209597 CTGCGGGGCGGGGCGAGGCCGGG + Intronic
1085454687 11:76659152-76659174 CAGCGGGGCCTGCCGAGCTCTGG + Exonic
1087634514 11:100687468-100687490 CCCCGAGGCTAGGCGAGCGCAGG - Intergenic
1088495692 11:110429847-110429869 CCATGGGGCGGGGCCAGCGCAGG - Intergenic
1089442799 11:118530920-118530942 CCGCGGACCCGGGCGTCCGCGGG + Exonic
1089457721 11:118635065-118635087 CCGCGGGGCCGGGGGAGGGGGGG - Intronic
1089556230 11:119317190-119317212 GCGCGGGGCGGGGCGGGCCCGGG - Intronic
1090211026 11:124921224-124921246 GCGAGCGGCCGGGCGAGCTCGGG + Exonic
1091225830 11:133956178-133956200 CCGCAGGGCCGCGCGAACCCGGG + Intronic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1091550302 12:1531027-1531049 CCGCGGGGCCGGGAAGGCGGAGG - Intronic
1092211207 12:6647441-6647463 GCGCGGGGCGGGGCGCACGCGGG + Exonic
1094025775 12:25958742-25958764 GCGGGGCGCCGGACGAGCGCGGG - Intergenic
1094199249 12:27780177-27780199 CGGAGAGGCCGGGCGAGCGCGGG + Exonic
1094536084 12:31324167-31324189 GCGCCGGGCCGGGCTGGCGCGGG - Intronic
1096143912 12:49264947-49264969 CCGCGGGTGCGGCCGGGCGCAGG + Exonic
1097164610 12:57076947-57076969 CTGCGGGGCGGGGCGGGCGGGGG + Intronic
1097895884 12:64824686-64824708 CCGCGGGAGCCGCCGAGCGCAGG - Exonic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1100565447 12:95790329-95790351 CAGCCGGGCCGGGCGGGTGCCGG + Exonic
1102053698 12:109880648-109880670 CCGGGGGGCCGGCCGGGGGCGGG + Intergenic
1102084384 12:110124261-110124283 GGGCGGGGCCGGGCCAGGGCGGG - Intergenic
1102370836 12:112381732-112381754 CCTCGGGGCCTGGCGCCCGCAGG - Intronic
1102651755 12:114447442-114447464 CCGCGGTGCCGGGCGGTCTCCGG - Intergenic
1103400626 12:120640824-120640846 CCGCCGGGCCATGCGAGCGCGGG + Exonic
1103547519 12:121712712-121712734 GCGTGGGGCGGGGCGGGCGCCGG + Intergenic
1103659240 12:122500562-122500584 GCGTGGGGCCGGGGCAGCGCCGG - Exonic
1103914515 12:124369548-124369570 GCGCAGGGCCGGGCGGACGCTGG - Intronic
1104841745 12:131828979-131829001 CAGCCGGGCTGGGCGAGAGCAGG + Intronic
1105378303 13:19864030-19864052 CCCCGGGCTCGGGCGAGGGCAGG - Intergenic
1105389169 13:19959095-19959117 CCGAGGGGCTGGGAGAGTGCGGG + Intronic
1105413737 13:20192527-20192549 GAGTGGGGCCGGGCGCGCGCGGG - Intronic
1105512399 13:21061448-21061470 CCGCAGGGACGGGGGAGCCCCGG + Exonic
1106109048 13:26760838-26760860 GCGGGCGGCCGGGCGCGCGCGGG - Intergenic
1107838819 13:44435241-44435263 AGGCGGCTCCGGGCGAGCGCGGG - Intronic
1108518188 13:51222280-51222302 GCGAGGGGCGGGGCGGGCGCGGG + Intergenic
1110860509 13:80341028-80341050 GGGCCGGGCCGGGCGGGCGCGGG + Intergenic
1112290765 13:98142950-98142972 GAGCGGGGCGGGGCGGGCGCAGG + Intronic
1112461377 13:99606508-99606530 CCGCGGGGCGGAGCGGGTGCTGG + Intergenic
1113655680 13:112066914-112066936 ACGCGGGGCCGGCGGCGCGCGGG - Intergenic
1115399192 14:32938960-32938982 CGGCGGCGCCGGGCGAGCAGCGG + Intronic
1117368276 14:55052090-55052112 CTGCGGGGCGGGGCGGGCGCGGG + Intronic
1117875759 14:60249148-60249170 CAGCGGGGCGGGGCGAGCGGAGG + Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1118992603 14:70809611-70809633 GCGCGGGGCGGGGCGGGCGTGGG - Intergenic
1119410285 14:74426098-74426120 GCGCGGGGCGGGGCGGGCGGCGG - Exonic
1119731958 14:76956680-76956702 CCGCGGGCCGGGGCTGGCGCTGG + Intergenic
1121168829 14:91836332-91836354 GCGCGGCGCCGGCCCAGCGCGGG - Intronic
1121342942 14:93115878-93115900 CGGGGCGGCCGGGCCAGCGCGGG - Intronic
1122081805 14:99272039-99272061 CCGCGGCGCCAGGGGAGCGCTGG - Intergenic
1122130899 14:99604180-99604202 CCGCGGTGCCGGGCGCTCTCAGG + Intergenic
1122689009 14:103522765-103522787 CCGGGCGGCCGGGCGGGGGCGGG + Exonic
1122768175 14:104085570-104085592 CCGCGGAGGCGGGCGGGGGCAGG - Intergenic
1122770428 14:104095331-104095353 CCTCGGGGCAGGGAGAGCGTGGG + Intronic
1122779127 14:104136289-104136311 GCGCGGCGCGGAGCGAGCGCAGG + Intergenic
1122904544 14:104795754-104795776 GCGCGGGGCGGGGAGAGGGCGGG - Intergenic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122917389 14:104865380-104865402 CCGCCCGCCCGGCCGAGCGCTGG - Exonic
1122919964 14:104875989-104876011 CCGCTGGGCCGTGGGAGTGCTGG - Intronic
1123030613 14:105449519-105449541 CAGCCGGGCCGGCCGGGCGCAGG - Intronic
1124426979 15:29570748-29570770 GCGCCGGGCCGGGCGGGAGCGGG - Intergenic
1125541325 15:40471429-40471451 CCTCGCGGCCGGGCGGGTGCAGG - Exonic
1126767053 15:52019604-52019626 CCGCGCGGGCGGGCGGGCGGCGG + Intronic
1127103374 15:55588669-55588691 CCGCGGGGTCGGGCGTTCTCGGG - Intronic
1128423971 15:67521175-67521197 GCGCGCCCCCGGGCGAGCGCCGG - Exonic
1129274007 15:74433708-74433730 CCGCGCGGCCGGTCAGGCGCGGG - Intronic
1129540344 15:76342847-76342869 CCGCGGCGCCGAGCGAGAGTGGG - Intergenic
1129817237 15:78565694-78565716 CCGCGGTCCCGCGCGGGCGCGGG + Exonic
1129827104 15:78641197-78641219 CCGCGCGGTCGAGTGAGCGCCGG + Exonic
1129854015 15:78811499-78811521 CCGAGGGGCGGGGCGGGGGCCGG - Intronic
1129871624 15:78945111-78945133 GCGCGGGGCGGAGCGAGCGCGGG + Intronic
1131160606 15:90102470-90102492 ACGCTGGGCCTGGCGGGCGCTGG + Exonic
1131517548 15:93089148-93089170 CCGCTGGGCCGGGGAAGCACTGG - Intronic
1132498598 16:275113-275135 CCGCGGAAGCGGGCGAGGGCGGG + Intronic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1132685060 16:1158791-1158813 CTGCGGGGCCGGGGGTGCGGCGG - Intronic
1132719445 16:1308793-1308815 CGGGGGGGCCGGGAGAGCCCGGG + Intergenic
1132754163 16:1474664-1474686 CGGCGGGGCCGGGCTGGCGGGGG - Intronic
1133006028 16:2882449-2882471 CCGCGGGGCTGGGAGAGCCGCGG + Intergenic
1133271961 16:4614647-4614669 CGCCGGAGCCGGGCGAGGGCCGG - Intronic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1136279499 16:29199685-29199707 CGGCGGGGCCGGGCTGGGGCAGG - Intergenic
1136390632 16:29962109-29962131 CCTCGGGGCCGGGCGGAGGCCGG - Intronic
1136574906 16:31117731-31117753 TCGCGGGGGAGGGCGAGCCCGGG + Exonic
1137665381 16:50246329-50246351 CCGCGAGGCCGGGGAAGGGCGGG - Intronic
1138327897 16:56191135-56191157 GAGTGGGGCCGGGCGCGCGCCGG - Intergenic
1138360674 16:56425134-56425156 GCGCTCGGCCGGGCGGGCGCCGG + Exonic
1138619147 16:58197891-58197913 CCGCGGGGGCGGGCGGGCTGGGG + Exonic
1139496946 16:67326801-67326823 GGGCGGGGCCTGGCGTGCGCCGG + Intronic
1140273020 16:73483222-73483244 CCTCTGGGCCAGGCGTGCGCTGG - Intergenic
1141076268 16:81008622-81008644 GCGAGGGGCCGGGAGCGCGCCGG - Intronic
1141430520 16:83968493-83968515 CCGCGGGGACTGGCCGGCGCCGG - Intergenic
1141582775 16:85011509-85011531 GAGCGGGGCGGTGCGAGCGCCGG + Intronic
1141959000 16:87392248-87392270 CCGAGGGGCGGGGCCAGAGCCGG - Exonic
1142083890 16:88165786-88165808 CGGCGGGGCCGGGCTGGGGCAGG - Intergenic
1142136947 16:88455858-88455880 GCGCGGGGCCGGGGCAGCTCGGG + Intronic
1142509830 17:386259-386281 GGGCGGGGCGGGGCGGGCGCCGG - Intergenic
1142631423 17:1228943-1228965 CCGCGGCGAGGGGCGAGCCCGGG + Intronic
1143078762 17:4366325-4366347 CCGAGGGCCCGGGCTGGCGCCGG + Exonic
1143487223 17:7261660-7261682 CGGCGGGGCTGGGCGGGAGCGGG - Intronic
1143783153 17:9240005-9240027 GGGCGGGGCCGAGCGAGAGCGGG + Exonic
1144847045 17:18225550-18225572 GCGCGGGGCCGGGCCTGCACGGG - Intergenic
1146445343 17:32928249-32928271 CCGCCGGGCCGGGCGGGCCGCGG + Intronic
1146774032 17:35596583-35596605 CCGCCGGGCCTGGCAGGCGCGGG - Intronic
1146843055 17:36168027-36168049 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146855360 17:36255968-36255990 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146865261 17:36332407-36332429 CAGCGGGGCCTGGGGAGCCCTGG + Intronic
1146871266 17:36379879-36379901 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146878626 17:36430961-36430983 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1146882574 17:36452107-36452129 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1146888275 17:36486849-36486871 CCGGGAGGCCGGGCGGGAGCGGG + Intronic
1147068121 17:37933001-37933023 CAGCGGGGCCTGGGGAGCCCTGG + Intronic
1147074152 17:37980503-37980525 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1147079651 17:38012556-38012578 CAGCGGGGCCTGGGGAGCCCTGG + Intronic
1147085674 17:38060041-38060063 CAGCGGGGCCTGGGGAGCCCTGG - Intronic
1147095592 17:38136498-38136520 CAGCGGGGCCTGGGGAGCCCTGG + Intergenic
1147101621 17:38184007-38184029 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1147258994 17:39197728-39197750 GGGCGGGGCCGGGCGGGCGGAGG - Intergenic
1147469676 17:40647820-40647842 GCGAGGGGCGGGGCGAGCGCGGG - Exonic
1147599024 17:41734416-41734438 CTCCGAGGCCGGGCGAGCTCCGG + Exonic
1147907552 17:43832917-43832939 GCGCGCGGCGGGGCGGGCGCGGG + Intronic
1148081101 17:44968089-44968111 GCGCGGAGCCTGGGGAGCGCCGG + Intergenic
1148615333 17:48996790-48996812 CCGGGGGACCCTGCGAGCGCGGG - Intergenic
1149296406 17:55265691-55265713 CCGCGGGACAGGGCGGGAGCGGG - Intronic
1149491154 17:57085827-57085849 CCGCGGGGCTGGGCGACCTTGGG - Exonic
1149846219 17:60010513-60010535 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1149994062 17:61397594-61397616 CCGCGGGGCGGGGCGAGTGGTGG + Intergenic
1150084568 17:62267093-62267115 CAGCGGGGCCTGGGGAGCCCTGG - Intergenic
1150489006 17:65561689-65561711 GGGCGGGGCGGGGCGGGCGCGGG - Intronic
1151453540 17:74213465-74213487 CGGCGGGGCGGGGCGGGCGCGGG + Intergenic
1151472330 17:74326123-74326145 GCGCGGGGAGGGGCGGGCGCCGG + Intergenic
1151660759 17:75516791-75516813 CCTTGGGGCCATGCGAGCGCTGG - Exonic
1151728338 17:75897025-75897047 ACGCGGGGCGGGGCGAGATCCGG + Intergenic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1151854360 17:76710695-76710717 CCGCGGGGCTGGGGGAGCTCGGG - Exonic
1152197261 17:78925095-78925117 CCGGGGGGCTGGGCGGGCGGGGG + Exonic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1152575828 17:81140642-81140664 CCGTGGGGCCGGGGGACCGTGGG + Intronic
1152575860 17:81140730-81140752 CCGTGGGGCCGGGAGACCGTGGG + Intronic
1152575889 17:81140816-81140838 CCGTGGGGCCGGGAGACCGTGGG + Intronic
1152628527 17:81399411-81399433 CCGCCGGCCCGAGCGAGCGGCGG - Intronic
1152870635 17:82751578-82751600 CCGGGGGGCGGGGCGGGGGCGGG - Intergenic
1152870796 17:82752053-82752075 TCGCGGGGCGGGGCCAGCGTCGG + Exonic
1153805473 18:8705882-8705904 CCGCGAGGTTGGGCGAGCGCGGG - Intronic
1153855128 18:9137296-9137318 GCGCGGGGCGGGGCGGGGGCCGG + Intronic
1153872655 18:9334858-9334880 CCGCCGGGTCGGCCGAGCCCGGG - Exonic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1159511395 18:69401340-69401362 CAGCCGGGCCGAACGAGCGCCGG - Intronic
1159586590 18:70288824-70288846 GCGCGGGGCGGGGCGGGGGCCGG - Intergenic
1160543313 18:79637625-79637647 CCGCGGGCCAGGGCGGGCGGCGG - Intergenic
1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG + Exonic
1160592405 18:79951746-79951768 GCGCTGGGCAGGGCGGGCGCAGG + Intergenic
1160714985 19:572502-572524 CTCGGGGGCGGGGCGAGCGCCGG - Intronic
1160745439 19:709100-709122 CCGCGGTGCCGGGCGGGGGCGGG - Exonic
1160752013 19:738809-738831 CCGAGGGGCCAGGCGATGGCAGG + Intronic
1160766823 19:812545-812567 CGGCGGGGCCGGGGGCGGGCGGG - Exonic
1160913099 19:1483812-1483834 CGGCGGGGCCGGGCGGGGGCGGG - Intronic
1160930274 19:1567065-1567087 CGGCGGGGCGGGGCAAGCGCAGG - Intronic
1160935539 19:1592821-1592843 GAGCGGGGGCTGGCGAGCGCGGG - Intergenic
1160991924 19:1863632-1863654 GGGCGGGGCAGGCCGAGCGCGGG - Intergenic
1161112005 19:2475829-2475851 CCGCGGTTCGGGGCGCGCGCGGG - Intergenic
1161215678 19:3094215-3094237 GGGCGGGGCGGGGCGAGGGCGGG - Intergenic
1161313212 19:3606439-3606461 CAGCAGGGCAGGGCCAGCGCCGG + Intronic
1161313345 19:3606908-3606930 CCGAGGGGCGTGGCCAGCGCAGG - Intergenic
1161471272 19:4457725-4457747 CCGCGGGGGCGGGGGGGCACGGG + Exonic
1161495839 19:4585072-4585094 CCCCGGGGCTGGGGGAGTGCTGG + Intergenic
1162299309 19:9835273-9835295 CAGCGGCGGCGGGCGGGCGCGGG + Intronic
1162490900 19:10990972-10990994 CCCCCGGGCAGGGCGAGCACAGG - Intronic
1163117209 19:15195870-15195892 CCGTGGGGCGGGGCGCGGGCTGG - Intronic
1163638945 19:18450781-18450803 CCGCGGGGGCAGGTGAGTGCTGG + Exonic
1163720497 19:18896154-18896176 CAGCTGGGCCGGGGGCGCGCGGG + Intronic
1163807083 19:19405931-19405953 CCGCGGGGCCGGGCGGCGGAGGG - Intronic
1163830329 19:19544483-19544505 CCGCGGAGCCGGGCGCACGGAGG - Exonic
1164639116 19:29811914-29811936 CGGCGGGGCGGTGCGAGGGCGGG + Exonic
1164958393 19:32405949-32405971 CCGAGAGGGCGGGCGGGCGCCGG + Intronic
1165061124 19:33205702-33205724 ACGAGGGCCTGGGCGAGCGCGGG + Exonic
1165318530 19:35072330-35072352 CCGAGGGGCAGGGCTGGCGCTGG + Intergenic
1165460272 19:35940110-35940132 CCCCGGGGCCTGGCGAGCAGGGG - Exonic
1166047077 19:40235936-40235958 CCTCGGGGCTGAGCGTGCGCGGG + Exonic
1166294647 19:41883105-41883127 CGGAGGTGCCGGGCGGGCGCGGG + Intergenic
1166367119 19:42283627-42283649 CAGCGGGGCCAGGCGCGCCCAGG + Intronic
1166790418 19:45395781-45395803 CCGCGGAGCCCAGCGAGCGCCGG + Exonic
1166941775 19:46371384-46371406 CCCTGGGCCCTGGCGAGCGCTGG - Intronic
1167045320 19:47045955-47045977 CCGTGGGGCCTGGCAGGCGCTGG - Exonic
1167466133 19:49651874-49651896 GCGCCGGGGAGGGCGAGCGCTGG - Exonic
1167613293 19:50517546-50517568 CGGCGGGGCCGGGCGGGCGAGGG - Exonic
1167660296 19:50792213-50792235 GCGCGGGGCTGGGTGAGCCCAGG - Intronic
1168240432 19:55086437-55086459 CAGCGGGGCCGAGCCAGAGCTGG - Exonic
1168308910 19:55451236-55451258 GGGCTGGGCCGGGCGGGCGCCGG + Intergenic
1168407872 19:56120420-56120442 CCACGGGGCAGGGCGAAGGCGGG - Intronic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
926299560 2:11592888-11592910 CCGCGGCGCTGGGCGCGGGCGGG - Exonic
926423074 2:12717474-12717496 CCGCGCGGCGGGCCGAGCCCAGG + Exonic
927472106 2:23384904-23384926 CCGCGGAGCCAGGCGAGCCGGGG + Intergenic
927472618 2:23386620-23386642 TCGGGGGGCCGGGGGAGCCCAGG + Intronic
927679772 2:25131917-25131939 GCGCGGGGCCGGGCCGGGGCGGG + Intronic
927811878 2:26185010-26185032 CCGGGGGCGCGGGCGAGCCCGGG - Exonic
927983843 2:27393496-27393518 CCGGGGTGCAGGACGAGCGCCGG + Intronic
927997269 2:27494975-27494997 CCGCGTCGCCGGGCCCGCGCCGG - Exonic
929188635 2:39120551-39120573 CCGCGCAGCCGGGCTAGCCCTGG + Intronic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
932313896 2:70767412-70767434 CCCCGGGGCCTCGCGATCGCTGG - Intronic
934954748 2:98608359-98608381 CCGCAGGGCGGCGCGTGCGCGGG - Exonic
934966900 2:98731210-98731232 CCGCGGGGCCGGCCAATGGCTGG - Intergenic
935112421 2:100105149-100105171 GGGCGGGGCCGGGCGCGGGCGGG - Intronic
935196676 2:100820370-100820392 CCGCGGGGCCGGGCGCGGACTGG - Exonic
935645342 2:105329696-105329718 CTGCGGGGTCGGGCCAGCCCAGG - Exonic
935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG + Exonic
936104530 2:109613746-109613768 CCGCGGGGGCCGGGGAGCGCGGG + Intronic
937221458 2:120345128-120345150 CCGCAGGGCCGGGAGAGAGCGGG - Intergenic
938034876 2:128027642-128027664 CAGAGCGGCCGGGGGAGCGCGGG - Intronic
938368808 2:130756197-130756219 CCGCGGGGTCGGGCAGGCGAGGG - Intronic
938500511 2:131829513-131829535 CTGCGGGGCGGGGCGGGCCCAGG + Intergenic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941008365 2:160270320-160270342 CCGCGGGGCCCCCCGGGCGCAGG - Intronic
941104868 2:161341075-161341097 CCGCGGGGCTGGGGGAGCTCGGG - Intronic
941111760 2:161424232-161424254 CGGCGGGGCCGGGCGGGCAGGGG - Exonic
941929116 2:170923623-170923645 CAGCGGGGCTGGGCTAGCCCAGG - Intergenic
947399132 2:229714604-229714626 GGGCGGGGCGGGGCGAGCGGGGG + Intergenic
948206908 2:236167384-236167406 AGGCGGGGGCGGGCCAGCGCCGG - Intronic
948216589 2:236237423-236237445 CCGGGGCGCGGGGCGAGGGCCGG + Intronic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
949057492 2:241936532-241936554 CTGCGGGGCGGGGCGTGCGCGGG - Intergenic
1168878238 20:1185487-1185509 CCGCGGCGCTCGGCGAGCCCCGG - Intronic
1169214714 20:3786485-3786507 CCCCGGGGCGGGGGGCGCGCCGG - Exonic
1169327401 20:4686838-4686860 CCGCTGGGCCGGACCCGCGCGGG - Intronic
1169801446 20:9515952-9515974 CCCCGGGGCCGGGCGAGCTGAGG + Intronic
1171908631 20:30921504-30921526 CCGCCTGGTCTGGCGAGCGCAGG + Intergenic
1172109330 20:32536269-32536291 CCGCGGGGCCTGGCTGGCTCAGG - Intronic
1172277306 20:33686564-33686586 TGGCGGGGCGGGGCGCGCGCAGG + Intergenic
1172284660 20:33732177-33732199 CCGCGGGGCGGGAGGGGCGCGGG + Intronic
1172583204 20:36064647-36064669 CCCAGGGGCAGGGCCAGCGCGGG + Intergenic
1174658694 20:52192155-52192177 GCGCGGGGCGCGGCGAGCTCCGG + Intronic
1175036550 20:56005479-56005501 CCCTGGGGCCTGGCGAGCTCAGG + Intergenic
1175267291 20:57710256-57710278 CCCCGGCCCCGGGCGTGCGCCGG - Intronic
1175913869 20:62416702-62416724 CCACGGGGCCAGGCGACCCCAGG - Intronic
1175992050 20:62794507-62794529 CCGCGGGGCGGGGCCGGGGCCGG - Intergenic
1176194393 20:63830824-63830846 GCGCGGGGCGGGGCGCGCGGGGG - Intronic
1176242142 20:64080056-64080078 GTGCGGAGCCGGCCGAGCGCGGG - Intergenic
1176550088 21:8217180-8217202 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176569015 21:8400215-8400237 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176576929 21:8444450-8444472 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1178334624 21:31732152-31732174 CGACGGGGCGGGGCGAACGCCGG - Intergenic
1179243838 21:39613086-39613108 GCGCGGGGCGCGGGGAGCGCTGG + Intronic
1179968048 21:44818154-44818176 CCGGGGCGTCGGGCGCGCGCAGG + Intronic
1180650215 22:17370304-17370326 CGGCGGGGCCGGGCGCGGGGGGG + Intronic
1180908397 22:19431658-19431680 CGGCGGCGGCGGCCGAGCGCGGG - Exonic
1181017597 22:20080240-20080262 CTGCCGCGCCGGGCGAGCGGAGG - Exonic
1181047876 22:20224137-20224159 CCGCAGGGCCAGCCGGGCGCAGG + Intergenic
1181094357 22:20495627-20495649 GCGCGGGGGCGGGCGCGGGCCGG - Intronic
1181283510 22:21736088-21736110 GCGCGGGGCGGGGCGAGAGCAGG + Intergenic
1182278633 22:29205846-29205868 CAGAGGGGCCGGGCGAGGCCGGG + Exonic
1183264472 22:36816868-36816890 CTGCGGGGCCGGCGGAGTGCAGG + Intronic
1184086913 22:42270727-42270749 CGGCGGGGCGGGGCGCGCGGCGG + Intronic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184265170 22:43342795-43342817 GCGCGGGGCGGGGCGGGCGGAGG - Intronic
1184676265 22:46045023-46045045 CAGCGCCGCCGGGCGAGGGCGGG - Intergenic
1185055280 22:48575909-48575931 CCCCGGGCCGGAGCGAGCGCGGG + Intronic
1185397581 22:50600736-50600758 GAGCGGGGCGGGCCGAGCGCCGG + Exonic
1203254978 22_KI270733v1_random:133506-133528 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203263034 22_KI270733v1_random:178585-178607 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
950193280 3:10992595-10992617 CGGCGGGCCTGGGGGAGCGCTGG + Intergenic
954437488 3:50503723-50503745 GCGCGGGGGCGGGCCAGCCCGGG - Intronic
954469008 3:50675413-50675435 CCTCGGCGCGGGGCGAGCGCGGG + Intronic
954763951 3:52897480-52897502 CAGCGAGGCCGGGCGGGCCCTGG - Exonic
958900097 3:99876084-99876106 CGCCGGGGCCGGGCGGGGGCCGG + Intronic
960047539 3:113212166-113212188 CCGGGCGCCCGGCCGAGCGCTGG - Intronic
960096698 3:113696506-113696528 CTCCGGGGCTGGGGGAGCGCGGG + Exonic
961182524 3:124887494-124887516 AGGCGGGGCGGGGCGAGCTCCGG + Intronic
961365109 3:126394795-126394817 CCGCGGGACAGGGAGGGCGCGGG - Intergenic
962575398 3:136751758-136751780 CAGCGGGGCCGGGCCGACGCGGG - Intronic
962751015 3:138434849-138434871 GCTCGGGGCCCGGCGTGCGCTGG - Exonic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
964118816 3:153162097-153162119 CCGCGGGGCCGGGAGGGGGCGGG - Intergenic
964771241 3:160225963-160225985 CCGCGCGGCCAGGCGCGCCCGGG + Exonic
966684889 3:182682926-182682948 CCGTGGGCCCGGGCGAGGGGCGG + Intergenic
966787754 3:183636127-183636149 CCGCGGGGCCGGGCGCCGCCGGG + Intronic
966919912 3:184604516-184604538 CGGCGGGGCCGGGCGAGGGTGGG + Intronic
967055466 3:185825510-185825532 CGCCGAGGCCGGGCGAGCGGCGG + Intergenic
967904089 3:194486749-194486771 CGGCGGGGCCGGGCCGGCCCTGG + Intronic
968090550 3:195895912-195895934 GCGCGGAGCCGGCTGAGCGCAGG - Intronic
968503455 4:961432-961454 CCGAGTGGGCGGGCGAGCCCAGG - Intronic
968541651 4:1171236-1171258 GCGCGGGGCCGGCCGGGGGCGGG - Intronic
968597462 4:1492815-1492837 CCGTGGGGCCGGGCGCACGTCGG + Intergenic
968599853 4:1503738-1503760 CCGGGGAGCCGGGGGAGCCCGGG - Intergenic
972418804 4:38867870-38867892 CCCGGGGGGCGGGCGAGCGCGGG + Intronic
972511273 4:39770577-39770599 CCGGGAGGCCGGGCCAGCGTGGG - Intronic
977064976 4:92303904-92303926 CAGCGGGGCCGGGCCAGAGGAGG - Intronic
981531950 4:145761919-145761941 CCGAGGGGCCGGGCGGGGGCTGG - Intronic
984639272 4:182144539-182144561 CCGCGCGGCCGGGGGCGGGCAGG + Intronic
986330524 5:6713666-6713688 ACGCGGCGCGGGGCGGGCGCGGG - Intergenic
986566655 5:9122709-9122731 CTGCGGGGCCGGGCTGTCGCAGG + Exonic
988722465 5:33892220-33892242 GGGCGGGGCCGGAGGAGCGCGGG - Intergenic
990910135 5:60844176-60844198 CCGAAGCGCCGGGCGCGCGCGGG + Exonic
992473187 5:77077512-77077534 CAGCGGGGCCGGGCGGCGGCGGG + Exonic
992671909 5:79069679-79069701 CCGCGGGGCCGGCGGGGCGGGGG + Intronic
992939630 5:81750417-81750439 CGGCGGTGCCGGGCGCGCGGCGG - Intronic
995512442 5:112922306-112922328 CGGCCGGGCGGGGCGAGCGGAGG - Exonic
996404100 5:123089874-123089896 CCGCGGAACCGGGCGGCCGCCGG + Intronic
997950921 5:138241981-138242003 GCACGGGGCTGGCCGAGCGCCGG - Intergenic
998552859 5:143094096-143094118 CCGCGGGGGCGGGGGAGTGGTGG - Intronic
998583574 5:143404054-143404076 CCGCGGAGCTGGGCGGGGGCGGG - Intronic
1001462041 5:171924675-171924697 CCACGGGGCCAGGCCAGCCCAGG + Intronic
1002527279 5:179821573-179821595 TGGAGGAGCCGGGCGAGCGCCGG + Intronic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003099038 6:3163120-3163142 CCGCGGCGCAGGGGGAGGGCGGG + Intergenic
1003290653 6:4776212-4776234 CGGCGGGGCCGGGAGCGAGCCGG - Intronic
1003290737 6:4776486-4776508 CCGCGGGGCCGGGCGGGCTGGGG - Exonic
1004864408 6:19838356-19838378 CGGCCGGGCTCGGCGAGCGCGGG + Intronic
1004924478 6:20403720-20403742 CGGCGGCGCAGGGCGAGGGCGGG - Intronic
1006134886 6:31889174-31889196 CTGGGGGGCCGGGCGGGGGCTGG + Intronic
1006509617 6:34514997-34515019 CCGCTGGGCCAGGCCAGGGCTGG - Intronic
1006606298 6:35259881-35259903 GCGGGAGGCCGGGCGGGCGCAGG + Intronic
1007079417 6:39088283-39088305 TCGGGGGGCCGGGGGAGCGGGGG - Intergenic
1007465584 6:42048930-42048952 CGGCGGGGCCGGGGCAGCACGGG + Intronic
1007665414 6:43510387-43510409 GCAGGGGGCGGGGCGAGCGCCGG - Exonic
1014018855 6:116565476-116565498 CCGCAGGGCCAGGCCAGAGCGGG - Intergenic
1016010887 6:139135948-139135970 CGGCGGGGCAGTGCCAGCGCGGG - Intronic
1016439009 6:144064539-144064561 CGGCGGGTCCGGGCGGCCGCTGG + Intronic
1017725738 6:157274921-157274943 CCGCGGGGACTGCAGAGCGCGGG + Intergenic
1017810707 6:157981734-157981756 GCGCGGGGCCGGGCGGGAGGCGG + Intergenic
1018670103 6:166169888-166169910 CCGCGACGCCGTCCGAGCGCAGG - Intergenic
1018942601 6:168319455-168319477 CCGCAGGGCGCGGCGGGCGCGGG + Exonic
1019171609 6:170136270-170136292 CCCCAGGCCCGGGCGAGCGGGGG - Intergenic
1019279521 7:192915-192937 CCGCGGAGCCGGGCGCGCGGGGG - Intergenic
1019360342 7:601611-601633 CGGCGGGGCCGGGCGGGGCCGGG - Intronic
1019395429 7:815840-815862 CCGCCGCTCCGGGCGTGCGCAGG - Intergenic
1019437153 7:1028179-1028201 CCGCGGGGCGGGGCTGGGGCAGG + Intronic
1019781014 7:2939719-2939741 CCTGGGGGCGGGGCCAGCGCGGG - Intronic
1020002958 7:4765979-4766001 CCGCGGGGCCAGAGGAGCTCAGG + Exonic
1020274355 7:6615647-6615669 CCGGGCGGGCGGGCGAGCCCAGG + Exonic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1022094637 7:27130927-27130949 GCACGGGGCGGGGCGCGCGCTGG - Intronic
1022107238 7:27205249-27205271 CCGGGGCGCTGGGCGAGCGCGGG + Intergenic
1024472125 7:49775274-49775296 CGGCGGGCCGGGGCGCGCGCGGG + Intronic
1024920256 7:54546661-54546683 CCGCGCGGCAGGGACAGCGCCGG + Intronic
1027244664 7:76358965-76358987 CCGCGGGACCGGGCGCGAGGCGG + Exonic
1029215961 7:98949849-98949871 CCGCGGGGCAGGGCGGGAGGAGG - Intronic
1029640820 7:101817602-101817624 CCGCGGCGCCGGGACAGCCCCGG + Intronic
1029813981 7:103075232-103075254 CCGCAGCGCCGGGCCAGGGCAGG - Exonic
1033662061 7:143408891-143408913 GCGGGGGGCGGGGCCAGCGCCGG + Exonic
1034222972 7:149460090-149460112 CCGCGCGTCCGTGCGCGCGCGGG + Intronic
1034422382 7:150996466-150996488 CCGGGGGGCCGGGGGAGGGCCGG - Exonic
1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG + Intronic
1034522580 7:151632200-151632222 GCTCGCGGCCGGCCGAGCGCTGG + Intronic
1034680689 7:152925478-152925500 CCGAGGGGCCGGGCGCGCGCGGG + Intergenic
1035264988 7:157685461-157685483 CCGAGGCGCAGGGCGACCGCCGG + Intronic
1036432162 8:8701855-8701877 CCGCCGGGCCAGGCGGGCGGTGG - Intergenic
1036766947 8:11555368-11555390 CTGCGGGGCCGGGCGCACACAGG - Exonic
1036910827 8:12755560-12755582 GGGCGGGGCCTGGCGAGGGCGGG + Intronic
1036950265 8:13133337-13133359 CCGAGGGGCGGGGCCAGAGCGGG + Intronic
1037262781 8:17027132-17027154 CCCCGGGGCCGCGCGAGTGTAGG + Intergenic
1039453847 8:37695665-37695687 CCCCGGGGCGGGGAGAGCGGCGG - Intergenic
1039885106 8:41650060-41650082 CCCCGGGGCCTGGCGGGTGCCGG + Intronic
1041083496 8:54235442-54235464 ACACGGGGCCGGGTGAGAGCAGG + Intergenic
1041792656 8:61714380-61714402 CCGCGGGGGCTGGTGAGGGCTGG + Exonic
1042561157 8:70072558-70072580 CGTCGGGGGCGGGCGGGCGCGGG - Intergenic
1045443631 8:102239060-102239082 AGGCGGGGCCGGGCCGGCGCAGG - Exonic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049419547 8:142510758-142510780 CCGCGGGGCCTGGCGGCGGCGGG + Intronic
1049585408 8:143430506-143430528 CGGCGGGGGCGGGGGGGCGCCGG + Intergenic
1049697158 8:143990017-143990039 GGGCGGGGCCGGGCGAGCTTCGG - Intronic
1049762665 8:144338150-144338172 GCGCGGGGCCGGGCGGCCGGGGG - Intergenic
1049766662 8:144358272-144358294 GCGCGGGGCCGGGCGGGGCCGGG + Exonic
1053163472 9:35829254-35829276 CCGCGGGGCCTGGTTATCGCCGG + Intronic
1055321743 9:75088809-75088831 GCTCGGGGCCGGGTGCGCGCCGG - Intronic
1056746808 9:89310624-89310646 CGGCTGGGTCGGGGGAGCGCCGG - Intergenic
1057146972 9:92764947-92764969 GCCGGGGGCCGGGCGGGCGCCGG - Intergenic
1057314601 9:93960377-93960399 CCGCCGGGGCTGGCGAGCGGTGG - Intergenic
1057466252 9:95317267-95317289 CCGCGGGGCGGGGCCAGGGCGGG - Intronic
1057547265 9:96027625-96027647 CCGGGGGGACGGGTGGGCGCTGG - Intergenic
1059176653 9:112174910-112174932 TCGCGGGGTCGGGCGGGGGCAGG + Intronic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1060106526 9:120876585-120876607 GCGCGGGGCCGGGCGGGGGCAGG + Intronic
1060713062 9:125889874-125889896 GCGCCGGGCAGCGCGAGCGCGGG - Intronic
1060796194 9:126514403-126514425 CCGCAGGGCCCAGCGAGGGCCGG - Intergenic
1060897025 9:127224902-127224924 GCGCGGGGCGGGGCGTGGGCGGG + Intronic
1061084918 9:128393113-128393135 GCGCGGGGCTGGGCGGGGGCGGG - Intergenic
1061248414 9:129413365-129413387 GCGGGGGGCAGGGCGAGAGCAGG - Intergenic
1061248443 9:129413424-129413446 CCGGGGGGCCGCCCGAGCTCCGG + Intergenic
1061559526 9:131393917-131393939 CCCGGGGGCCGGGCGAGGGCTGG - Intergenic
1061587706 9:131579345-131579367 CAGCGGGGCCGGGCGGGAGCTGG - Exonic
1062364734 9:136203225-136203247 CCGCGGGGCGGGGCGGGGCCGGG + Intronic
1062408693 9:136410512-136410534 GCGCGGGGGCGGCCGAGCGGCGG - Exonic
1062414103 9:136439315-136439337 GCGCTGGGCCGGCGGAGCGCCGG + Exonic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1062653598 9:137590646-137590668 CTGGGGAGCGGGGCGAGCGCGGG + Intergenic
1203471380 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203479201 Un_GL000220v1:160624-160646 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1185621496 X:1453425-1453447 GGGAGGGGCGGGGCGAGCGCCGG - Intronic
1187826172 X:23334724-23334746 CCGCGGCTCCGGGAGAGCTCAGG + Exonic
1190881569 X:54495712-54495734 CGGCGGGGCCGGGGGCCCGCTGG + Exonic
1196463326 X:115950561-115950583 CCGGGGGGCAGGGCCAGGGCTGG - Intergenic
1196840196 X:119852738-119852760 CCGCTGGCCCGGGAGAGGGCGGG - Intronic
1198388036 X:136147384-136147406 GGGCGGGGCGGGGCGCGCGCGGG - Exonic
1200003149 X:153072341-153072363 TCGCCGGCCCGGGAGAGCGCAGG - Intergenic
1200004574 X:153077668-153077690 TCGCCGGCCCGGGAGAGCGCAGG + Intergenic
1200231048 X:154444038-154444060 CGGCGGGGCGGGGCGGGCGGTGG + Intergenic
1200239576 X:154486644-154486666 CCGCCGCCCCGGGCGCGCGCTGG + Exonic
1200249824 X:154546964-154546986 GGGCGGGGCGGGGCGAGGGCAGG + Exonic