ID: 1062560612

View in Genome Browser
Species Human (GRCh38)
Location 9:137139995-137140017
Sequence ACGTCTACACACACCAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062560612_1062560625 16 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560625 9:137140034-137140056 AGTGTGGGGGTGGGCATTCCGGG No data
1062560612_1062560624 15 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560624 9:137140033-137140055 CAGTGTGGGGGTGGGCATTCCGG No data
1062560612_1062560621 3 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560621 9:137140021-137140043 GCTGGAGTGTGTCAGTGTGGGGG No data
1062560612_1062560620 2 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560620 9:137140020-137140042 GGCTGGAGTGTGTCAGTGTGGGG No data
1062560612_1062560619 1 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560619 9:137140019-137140041 GGGCTGGAGTGTGTCAGTGTGGG No data
1062560612_1062560618 0 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560618 9:137140018-137140040 GGGGCTGGAGTGTGTCAGTGTGG No data
1062560612_1062560623 7 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560623 9:137140025-137140047 GAGTGTGTCAGTGTGGGGGTGGG No data
1062560612_1062560622 6 Left 1062560612 9:137139995-137140017 CCCTGACTGGTGTGTGTAGACGT 0: 1
1: 0
2: 0
3: 8
4: 70
Right 1062560622 9:137140024-137140046 GGAGTGTGTCAGTGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062560612 Original CRISPR ACGTCTACACACACCAGTCA GGG (reversed) Intronic
904027961 1:27516572-27516594 ATGGCTCCACACACAAGTCACGG - Intergenic
906086000 1:43135320-43135342 ACAACCACACACACCAGTCTGGG - Intergenic
908884763 1:68775877-68775899 ACTTCTACACACTACACTCATGG - Intergenic
909362061 1:74772639-74772661 ACGCCTATACACACTAGACAGGG + Intergenic
920084608 1:203406175-203406197 ACATCTGCAGACACCAGTCAGGG + Intergenic
1062794835 10:336854-336876 ACGCGCACACACACCAGTCTAGG - Intronic
1062794860 10:337082-337104 ACGCACACACACACCAGTCTAGG - Intronic
1065153861 10:22850049-22850071 ACCACTACACACTCCAGTCTAGG - Intergenic
1068227376 10:54123472-54123494 ATACCTACTCACACCAGTCAGGG + Intronic
1069750325 10:70741241-70741263 ACCCCTACATACACCAGTGAAGG + Intronic
1073740955 10:106406381-106406403 AAGTCTCCACACAGCAGCCAGGG - Intergenic
1073824019 10:107299561-107299583 ACGTATACACTCACAAGTAAAGG - Intergenic
1077361704 11:2143687-2143709 ACGTCAAAACACATCAGTCCCGG - Intronic
1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG + Intronic
1091817594 12:3451800-3451822 ACGTCAAGACACTCCAGTTAAGG - Intronic
1101173429 12:102123331-102123353 ACTTCTGCACACACCACTTAAGG + Intronic
1101989373 12:109471972-109471994 AGGCCTACACACTCCATTCATGG - Intronic
1106684700 13:32045979-32046001 AAGTGTACACACTCCAGTGATGG + Intronic
1109880830 13:68473126-68473148 ACGTCTACACACACCATGGCTGG - Intergenic
1111792226 13:92871954-92871976 AGGTCTAAATACACCAGTCAAGG - Intronic
1112354868 13:98665794-98665816 ACCCCTCCACAGACCAGTCATGG - Intergenic
1115153526 14:30312813-30312835 AAGTCTATCCACACCTGTCAAGG - Intergenic
1115236541 14:31213538-31213560 ACACATACACACACTAGTCAGGG + Intergenic
1119683135 14:76607758-76607780 ACGTGTGCACACACATGTCAGGG + Intergenic
1120885427 14:89448279-89448301 ACGCCCACACACACAGGTCAAGG + Intronic
1128716883 15:69915090-69915112 AGGTCTACAAACAGCAGTCAGGG + Intergenic
1136504169 16:30692210-30692232 ATGTCTCCACACAGCAGCCAGGG - Intergenic
1136514424 16:30759336-30759358 ACGTCTTCACACCCCAGGTAGGG - Exonic
1147397414 17:40155221-40155243 ACGTATAAACACCCGAGTCATGG - Intronic
1159140810 18:64391633-64391655 ACAGTGACACACACCAGTCATGG + Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
933626103 2:84601675-84601697 TGGTCTACACACACCTGTTAAGG - Intronic
933731385 2:85458824-85458846 ACCTATTCCCACACCAGTCATGG + Intergenic
934890332 2:98062495-98062517 AAGTCTACAGATACCAGTCTAGG + Intergenic
937641023 2:124211607-124211629 TCATCTACATACACCAGTAAAGG + Intronic
943389644 2:187248732-187248754 AAGTCTAAACACACCAGTCTGGG + Intergenic
948189410 2:236046322-236046344 ACCTCTTCACACAGCAGCCAGGG - Intronic
1169178747 20:3543186-3543208 ACGTATACACACACCTGTGTGGG + Intronic
1169350084 20:4861742-4861764 GCGTGTACACATAACAGTCATGG - Intronic
1173553711 20:43950679-43950701 ACGTTTAAACAGAGCAGTCAAGG - Intronic
1179883523 21:44303572-44303594 ACGTCCAAACACACCAGCCAGGG - Intronic
1180843437 22:18969785-18969807 ACCCCTACACACACCACACAGGG - Intergenic
951427976 3:22571095-22571117 GGGTCAACACACACCAGTTAAGG + Intergenic
955844866 3:63151913-63151935 ACACATACACACACAAGTCATGG - Intergenic
956445182 3:69319098-69319120 ACCTCTACACAAACCTATCAAGG + Intronic
957643918 3:82894819-82894841 ACATATGCATACACCAGTCAGGG - Intergenic
958599099 3:96270694-96270716 ATGTCTACAAAAACCAGACATGG + Intergenic
964310627 3:155387730-155387752 ACGTCTGCACAAACCACTGAAGG - Intronic
964962665 3:162447299-162447321 AATTCTCCACACAGCAGTCAAGG - Intergenic
966048896 3:175588986-175589008 ATGTATACACACACCATTTATGG - Intronic
970282114 4:14468652-14468674 GTGTCTACACACACCAGTTCTGG + Intergenic
980183468 4:129431956-129431978 GTGTGTATACACACCAGTCATGG - Intergenic
985760847 5:1747765-1747787 ACTTCTTCACACACAAGGCAAGG - Intergenic
987063824 5:14268544-14268566 ACGTCCACACCCACACGTCATGG - Intronic
987642930 5:20634435-20634457 ATGCCTACACACACGAGCCACGG + Intergenic
992348335 5:75903324-75903346 ACTCCTACACACAACACTCAAGG - Intergenic
992552915 5:77876096-77876118 AAGTATACACACTGCAGTCAAGG + Intergenic
999044117 5:148449088-148449110 ACCTCTACAGACACCAATCATGG + Intergenic
1004709615 6:18156429-18156451 ACGTATACACACATAACTCAAGG + Intronic
1005719869 6:28590397-28590419 TCGTCTACACACACAGTTCAGGG - Intronic
1018427882 6:163699821-163699843 ACATCTGCCCACACCACTCATGG - Intergenic
1021231723 7:18093207-18093229 AAGTCTCCACACACCTGCCAGGG - Intronic
1023590649 7:41777768-41777790 GCCTCCACACCCACCAGTCAAGG + Intergenic
1030748318 7:113196772-113196794 ATGTTTCCACACACCAGTCAGGG - Intergenic
1033418132 7:141182337-141182359 ACTTCTTGACACACAAGTCAAGG - Intronic
1047532208 8:125686896-125686918 AGGTCAACAAACACCAGACAGGG + Intergenic
1050265265 9:3882969-3882991 ACGTCTACAATGAGCAGTCATGG - Intronic
1052751505 9:32496409-32496431 ATGTCTGCACACATCAGTGAGGG - Intronic
1053160325 9:35809509-35809531 ATGTCTGCACACACCAGAAATGG + Exonic
1056304658 9:85278000-85278022 AGGACTACACACTCCAGCCAGGG - Intergenic
1056694279 9:88833118-88833140 AGGTCCACACAAACCATTCAGGG + Intergenic
1058614851 9:106815168-106815190 ACACCCACACACACCTGTCATGG + Intergenic
1059071511 9:111142227-111142249 AAGTTTCCAGACACCAGTCAAGG + Intergenic
1062560612 9:137139995-137140017 ACGTCTACACACACCAGTCAGGG - Intronic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1200181378 X:154152833-154152855 ACGTCTGCACACAGAATTCAGGG - Intronic
1200187024 X:154189947-154189969 ACGTCTGCACACAGAATTCAGGG - Intergenic
1200192673 X:154227085-154227107 ACGTCTGCACACAGAATTCAGGG - Intronic
1200198428 X:154264889-154264911 ACGTCTGCACACAGAATTCAGGG - Intronic